talaromyces transformant, processes for producing a talaromyces transformant, a multiple talaromyces

专利摘要:
talaromyces transformants. The invention relates to a talaromyces transformant comprising one or more recombinant gene capable of producing cellulase in the absence of cellulase inducer in a glucose medium having a cellulase activity of 2 wsu / ml or more in a supernatant or broth. diluted 16 times.
公开号:BR112012011596B1
申请号:R112012011596
申请日:2010-11-04
公开日:2018-10-02
发明作者:Wihelmus Hermanus Vollebregt Adrianus；Pieter Los Alrik；Vonk Brenda；Maria Jacobus Sagt Cornelis；Alexander Van Den Berg Marco；Elisabeth Francoise Schooneveld-Bergmans Margo；Antonius Damveld Robbertus
申请人:Dsm Ip Assets Bv；
IPC主号:

专利说明:

(54) Title: TALAROMYCES TRANSFORMANT, PROCESSES FOR THE PRODUCTION OF A
TRANSFORMANT OF TALAROMYCES, A MULTIPLE TRANSFORMANT OF TALAROMYCES AND A POLYPEPTIDE COMPOSITION UNDERSTANDING ONE OR MORE CELLULASES, AND PROCESSES FOR THE SACARIFICATION OF LIGNOCELLULOSIC MATERIAL AND FOR THE PREPARATION OF A HERMESEERING PRODUCT (73) . Address: Het Overloon 1, 6411 TE Heerlen, NETHERLANDS (NL) (72) Inventor: ALRIK PIETER LOS; BRENDA VONK; MARCO ALEXANDER VAN DEN BERG; ROBBERTUS ANTONIUS DAMVELD; CORNELIS MARIA JACOBUS SAGT; ADRIANUS WIHELMUS HERMANUS VOLLEBREGT; MARGO ELISABETH FRANCOISE SCHOONEVELD-BERGMANS
Control Code: CCFDA7BF44582233 372A9794FF2ADDD3
Validity Period: 20 (twenty) years from 11/04/2010, subject to legal conditions
Issued on: 10/02/2018
Digitally signed by:
Liane Elizabeth Caldeira Lage
Director of Patents, Computer Programs and Topographies of Integrated Circuits
1/127
TALAROMYCES TRANSFORMANT, PROCESSES FOR THE PRODUCTION OF A TALAROMYCES TRANSFORMANT, OF A MULTIPLE TALAROMYCES TRANSFORMANT AND OF A POLYPTEPTICAL COMPOSITION UNDERSTANDING ONE OR MORE CELLULASES, AND PROCESSES FOR THE PROCESSING OF A MATERIAL OF LARGE MATERIAL
Field of the Invention
The present invention relates to a process for the production of Talaromyces transformants, to Talaromyces transformants and to a process for the production of polypeptide using Talaromyces transformants. The present invention also relates to a process for saccharification of lignocellulosic material, in which the lignocellulosic material is brought into contact with the cellulase transformant, hemicellulases and / or pectinase produced by the transformant, with sugars being produced. In addition, the invention relates to a process for the preparation of a fermentation product, ethanol, for example, these sugars being fermented with a fermentation microorganism, preferably a yeast, to produce the fermentation product.
Fundamentals of the Invention
Carbohydrates are the most abundant organic compounds on earth. However, a large part of these carbohydrates are sequestered in complex polymers including starch (the carbohydrate is mainly stored in seeds and grains), and in a combination of carbohydrates with lignin known as lignocellulose. The main components of lignocellulose carbohydrates are cellulose, hemicellulose and pectins. These polymers from 06/04/2018, p. 17/244
2/127 complexes are often collectively defined as lignocellulose.
The bioconversion of renewable lignocellulose biomass into a fermentable sugar that is subsequently fermented to produce alcohol (such as ethanol, for example) as an alternative to liquid fuels has attracted intense attention from researchers since the 1970s, when the oil crisis began due to the reduction in oil supply by OPEC. Ethanol has been used widely in the form of a 10% blend with gasoline in the United States or as a pure fuel for vehicles in the United States.
Brazil in the last two decades. More recently, the use of
E85, a mixture of 85% ethanol was implemented especially for applications for depollution of cities. The importance of bioethanol fuel will increase in parallel with increases in oil prices and with the gradual reduction of its sources. In addition, fermentable sugars are being used for the production of plastics, polymers and other biomass-based products and this industry is expected to grow substantially, thereby increasing the demand for abundant, low-cost fermentable sugars that can be used as raw material instead of petroleum-based raw material.
The sequestration of such large amounts of carbohydrates in plant biomass provides an abundant source of potential energy in the form of sugars, both five-carbon and six-carbon sugars that could be used for numerous industrial and agricultural processes. However, the enormous energy potential of these carbohydrates is currently used from 06/04/2018, p. 18/244
3/127 below their capacity, as sugars are trapped in complex polymers, and are therefore not easily accessible for fermentation. The methods that generate sugars from vegetable biomass would provide economically competitive abundant raw material for conversion by fermentation into chemicals, plastics, such as succinic acid and (bio) fuels including synthetic liquid fuels from ethanol, methanol, butanol and biogas.
Regardless of the type of cellulosic base, the cost and hydrolytic efficiency of enzymes are the main factors that restrict the commercialization of biomass conversion processes. The costs of producing microbiologically produced enzymes are closely associated with the productivity of the enzyme-producing strain and the final yield of the activity in the fermentation broth.
Despite ongoing research in the last few decades to understand the enzymatic degradation of lignocellulosic biomass and cellulase production, the discovery or construction of new extremely active cellulases and hemicellulases remains desirable. It would therefore be extremely desirable to build extremely efficient enzyme compositions capable of rapidly and efficiently biodegradating lignocellulosic materials.
Such enzymatic compositions can be used to produce sugars to be fermented and transformed into chemical substances, plastics, such as, for example, succinic acid and (bio) fuels, including ethanol, methanol, butanol, liquid synthetic fuels and biogas, for silage, and also as an enzyme in others from 06/04/2018, p. 19/244
4/127 industrial processes, such as for example in the food or feed industry, textiles, pulp or paper or detergents and other industries.
A genus of microorganisms that is known to produce enzymes suitable for the enzymatic degradation of lignocellulosic biomass is the genus Talaromyces. Talaromyces is a filamentous fungus.
Jian, S. et al. , Mol. Gen. Genet. (1992), 234, 489493 discloses a transformation system for the CL240 of the fungus Talaromyces sp. No polypeptide expression is described.
Murray, F. R. et al. , Curr. Genet. (1997), 32, 267375 discloses an overexpression of the glucose oxidase gene of Talaromyces flavus in Talaromyces macrosporus. The effect of fungal isolates on the growth inhibition of V. dahliae was studied.
W0200170998 describes beta-glucanases of Talaromyces emersonii. On page 16 it is described that the beta-glucanase polynucleotide can be heterologously expressed in a host, such as in a yeast cell.
WO200224926 describes Talaromyces emersonii xylanase. On page 24, paragraph 5, it is described that polypeptide production can be achieved by recombinant expression of the xylanase DNA sequence in a suitable homologous or heterologous host cell. In paragraph 7, it is stated that the host cell can overexpress the polypeptide, and techniques for constructing overexpression are known from WO99 / 32617. WO99 / 32617 refers to expression cloning, but does not disclose cloning in a Talaromyces host.
of 06/04/2018, p. 20/244
5/127
W02007091231 describes strains of Talaromyces emersonii that are thermostable and encode thermostable enzymes and also describes enzymatic compositions produced by the strains of Talaromyces emersonii. No recombinant production of homologous or heterologous polypeptides has been disclosed. Table 1 shows that inductive carbon sources were added in an amount of 0.2-6%. Cellulose and glucose (2%) were included for comparison. On page 78, line 28, it is stated that glucose does not completely repress the production of exoglycosity by the strains of Talaromyces emersonii (table 31A). Table 31A shows that IMI3933751 produces a beta-glucosidase activity of 31.90 IU with glucose as a carbon source, but no other cellulase activity, such as glucanase or xylanase. Due to the absence of such enzymatic activities, the IMI393751 strain is not suitable for the production of cellulases for the conversion of lignocellulose to glucose as a carbon source.
Summary of the Invention
The presence of a cellulase inducer needed so far in Talaromyces cellulase production methods has several disadvantages. First, the inducer, like a plant material, can have a variable composition, which is a disadvantage for the controllability of the cellulase production process. Second, energy is required to sterilize plant material for induction. Thirdly, plant material will greatly pollute the equipment. Fourthly, the inductor can result in a higher viscosity of the production medium from 06/04/2018, p. 21/244
6/127 cellulase. Fifth, the presence of the inducer, especially when it has been previously treated, can result in the production of inhibitors that can have a harmful effect on Talaromyces. There is, therefore, a need for an improved process and improved strains of Talaromyces for the production of polypeptide compositions suitable for the enzymatic degradation of lignocellulosic biomass in Talaromyces.
Therefore, an objective of the present invention is to propose strains of Talaromyces suitable for converting lignocellulose into sugar. Another objective is to propose such strains of Talaromyces that can be produced in glucose medium, without cellulase inducers. The invention now proposes a process for the production of a Talaromyces transformant that comprises the steps of:
(a) providing one or more expression cassettes capable of producing one or more polypeptides of interest and comprising one or more polynucleotides of interest encoding cellulase, hemicellulase and / or pectinase and at least one promoter for the expression of the polynucleotide;
(b) if it provides a selection marker included in the expression cassette of (a) or included in a dedicated selection marker polynucleotide;
(c) transfecting a Talaromyces host with the one or more expression cassettes from (a) and / or the selection marker from (b);
(d) selecting a Talaromyces transformant that contains one or more polynucleotides encoding cellulase, hemicellulase and / or pectinase and (e) isolating the Talaromyces transformant.
of 06/04/2018, p. 22/244
7/127
The present invention further proposes Talaromyces transformants that comprise one or more recombinant genes capable of producing cellulase in the absence of a cellulase inducer in a glucose medium, having a cellulase activity of 2 WSU / mL or more in supernatant or broth diluted 16 times or more, which can be obtained according to the above process.
The Talaromyces transformants of the present invention can be grown in a medium that comprises a suitable source of carbon, such as sugar, such as glucose, without a cellulase inducer (in this case glucose is not a cellulase inducer, that is, the inducer cellulase does not include glucose) and produces cellulases that have the activity of degrading lignocellulose.
The present invention also relates to a process for the production of a polypeptide composition of one or more cellulase, hemicellulases and / or pectinases and which comprises the steps of:
(a) providing one or more expression cassettes capable of producing one or more polypeptides of interest and comprising one or more polynucleotides of interest encoding cellulase, hemicellulase and / or pectinase and at least one promoter for polynucleotide expression;
(b) providing a selection marker included in the expression cassette of (a) or included in a dedicated selection marker polynucleotide;
(c) if a Talaromyces host is transfected with the one or more expression cassettes from (a) and / or with the selection marker from b);
(d) if you select a Talaromyces transformant who from 06/04/2018, p. 23/244
8/127 contains one or more polynucleotides that code for cellulase, hemicellulase and / or pectinase;
(e) producing the polypeptide composition by culturing the Talaromyces transformant in a suitable culture medium in which a cellulase inducer is substantially absent; and (f) optionally recovering the polypeptide composition.
Other modalities are described below in the detailed description of the invention
Brief Description of the Figures
Figure 1. Detection of PCR fragment of the pAN8-l βlactamase gene. Agarose gel showing the PCR fragment of the 278 nucleotide β-lactamase gene in T. emersonii transformants. Lanes 1-10 contain PCR fragments from PCR reactions that use T. emersonii pAN8-l transformant chromosomal DNA as template; lane 11 contains a molecular weight marker; lane 12 contains the PCR fragment from a PCR reaction using pAN820 plasmid 1 as a template for PCR; lane 13 contains a PCR reaction mixture using chromosomal DNA from an empty strain as a template.
Figure 2. Detection of pAN8-l integration into the T. emersonii genome. Southern blot detection of pAN8-l DNA using a probe labeled with β-lactamase. Lane 1 contains a molecular weight marker; lanes 2 and 3 contain, respectively, 0.5 and 5 ng of plasmid DNA pAN8-1; lanes 4 and 5 contain MluI-digested chromosomal DNA from two non-T pAN8-l transformants.
emersonii (specific bands are indicated by arrows); The
Petition 870180047364, of 06/04/2018, p. 24/244
9/127 lane 6 contains chromosomal DNA digested with MluI from an empty strain.
Figure 3. Map of pGBFINEBA7 for the expression of CEB protein from T. emersonii beta-glucanase identified with FLAG. pGBFINEBA7 is a plasmid based on pGBFIN5. The T. emersonii beta-glucanase CEB protein identified with FLAG (EBA7 + FLAG) expressed from the Aspergillus niger glycoamylase promoter (PglaA) is illustrated. In addition, the selection marker (amdS) gene, expressed from the Aspergillus nidulans glyclic aldehyde 3-phosphate dehydrogenase (Pgpd) promoter and the glycoamylase (3'glaA and 3glaA) flanks of the cassette of expression.
Figure 4. Detection of the T. emersonii beta-glucanase CEB protein identified with FLAG expressed in T.
emersonii.
(4A): SDS-PAGE detection of the CEB protein of T. emersonii beta-glucanase identified with FLAG, expressed in T. emersonii grown in Talaromyces medium 1 (lanes 1-3) and Talaromyces medium 2 (lanes 5-7) . Supernatants 1 # 6 (lanes 1, 5) and 1 # 14 (lanes 2, 6) of T. emersonii pGBFINEBA7 transformant collected from 72 hour cultures; lanes 3 and 7 contain supernatants from a 72-hour culture of an empty strain; lane 4 contains a molecular weight marker.
(4B): Western blot detection of CEB beta-glucanase protein identified by T. emersonii FLAG, expressed in T. emersonii grown in Talaromyces medium 1 (lanes 2-7) and Talaromyces medium 2 (lanes 9- 14), using an antibody specific to the FLAG identifier. The tracks of 06/04/2018, p. 25/244
10/127 and 8 contain a molecular weight marker; lanes 2, 3, 9 and 10 contain supernatants 1 # 6 of T. emersonii pGBFINEBA7 transformant collected from a 72 hour (lane 2, 9) and 96 hour culture (lane 3, 10); lanes 4, 5, 11 and 12 contain supernatants 1 # 14 of the transformant pGBFINEBA7 from T. emersonii collected from a 72 hour (lane 4, 11) and 96 hour culture (lane 5, 12); lanes 6 and 13, and 7 and 14 contain supernatants from 72 hour and 96 hour cultures, respectively, of an empty strain.
(4C): Determination of the number of copies of transformants by PCR. Agarose gel showing the 1285 nucleotide expression cassette PCR fragment and the 373 nucleotide PCR fragment of actin genomic control / reference from T. emersonii transformants. The intensity of the 1285 nucleotide PCR product of the EBA7 gene is indicative of the number of copies of the gene, after normalization of the 1285 nt PCR signal with the 373 nt actin genomic reference signal. PCR fragments 1 # 6 and 1 # 14 of the pGBFINEBA7 transformant are shown in lanes 1 and 2, respectively; lane 3 shows a molecular weight marker; fragments 8 # 14, 8 # 18, and 8 # 32 PCR from the pGBFIN-Pgpd-EBA7 transformant are shown in lane 4, 5, and 6, respectively.
Figure 5. Map of pGBFIN-Pgpd-EBA7 for the expression of the CEB protein of T. emersonii beta-glucanase identified with FLAG under the control of the gpd promoter. pGBFIN-Pgpd-EBA7 is a plasmid based on pGBFIN38. The T. emersonii beta-glucanase CEB protein identified with FLAG (EBA7 + FLAG) expressed from the glyceric aldehyde 3-phosphate dehydrogenase promoter of 06/04/2018, p. 26/244
11/127 of Aspergillus nidulans (Pgpd). In addition, the selection marker (amdS) gene, expressed from the glyclic aldehyde 3-phosphate (Pgpd) promoter (Pgpd) from Aspergillus nidulans and the glycoamylase flanks (3'glaA and 3glaA), are described of the expression cassette.
Figure 6. Comparison of the expression of the CEB protein of T. emersonii beta-glucanase in T. emersonii under the control of either the A. niger glaA promoter or the A. nidulans gpd promoter.
Western blot showing the CEB protein of T. emersonii beta-glucanase identified with FLAG, expressed in T. emersonii. Lanes 1, 10 and 11 contain 15 pL (lane
1), 15 µl of supernatant diluted 10 times (lane 10) and 5 µl (lane 11) of supernatant from a 72 hour culture of an empty strain; lanes 3-5 contain 15 pL of supernatant diluted 10 times (lane 3), 5 pL (lane 4) and 15 pL (lane
5) supernatant 8 # 14 from T. emersonii pGBFIN-Pgpd-EBA7 transformant collected from a 72-hour culture; lanes 6-8 contain 15 pL of 10-fold diluted supernatant (lane 6), 5 pL (lane 7) and 15 pL (lane 8) of supernatant 8 # 18 from T. emersonii transformant pGBFIN-Pgpd-EBA7 collected from a 72 hour culture; lanes 12-14 contain 15 pL of 10-fold diluted supernatant (lane 12), 5 pL (lane 13) and 15 pL (lane 14) of supernatant 8 # 32 from T. emersonii transformant pGBFIN-Pgpd-EBA7 collected from a 72 hour culture; lanes 9 and 15 contain 15 pL of supernatant 1 # 6 (glaA promoter) diluted 100 times from T. emersonii pGBFINEBA7 transformant collected from a 72 hour culture (due to the strong signal the bands are overexposed); lane 2 contains a weight marker
Petition 870180047364, of 06/04/2018, p. 27/244
12/127 molecular.
Figure 7: pGBTOPEBA205 map for the expression of
CBHI of T. emersonii in T. emersonii. EBA205 expressed from the glycoamylase promoter (PglaA) are illustrated. In addition, the glycoamylase (3'glaA) flank of the expression cassette is illustrated.
Figure 8: Map of pGBFINEBAl7 6 for CBHII expression of T. emersonii in T. emersonii. pGBFINEBAl7 6 is a plasmid based on pGBFINIL. The EBA176 gene expressed from the glycoamylase promoter (PglaA) is illustrated. In addition, the selection marker (amdS) gene, expressed from the Aspergillus nidulans 3-phosphate dehydrogenase (Pgpd) promoter from Aspergillus nidulans and the glycoamylase (3'glaA and 3glaA) flanks are illustrated expression.
Figure 9. Detection of multiple recombinant T. emersonii cellulases in T. emersonii.
(9A). Detection by SDS-PAGE of T. emersonii cellulases expressed in T. emersonii. T. emersonii was transformed with a mixture of pGBTOPEBA4, pGBTOPEBA8, pGBFINEBAl76, and pGBTOPEBA205. Approximately 400 transformants were grown in 96-well plates and tested for expression of at least one cellulase by SDS-PAGE analysis on gel. The transformants of interest were grown in shaken flasks containing glucose-based medium and proteins in supernatants collected from 72-hour cultures were precipitated with TCA and analyzed by SDS-PAGE analysis. FBG142 is the empty strain.
(9B). Graph showing WSU activity in transformers. The transformants were grown during 06/04/2018, p. 28/244
13/127 hours in glucose-based medium and WSU activity was determined in culture supernatants diluted 16 times. FBG142 was the empty strain.
Short description of the sequence list
SEQ ID AT THE: 1 presents the sequence in DNA of initiator 1 of PCR; SEQ ID AT THE: 2 presents the sequence in DNA of initiator 2 of PCR; SEQ ID NO: 3 displays the amino acid sequence in
T. emersonii β-glucanase CEB (protein) identified with FLAG;
SEQ ID NO: 4 shows the CEB coding sequence of T. emersonii β-glucanase identified with FLAG (DNA, coding region);
SEQ ID AT THE: 5 presents the sequence in DNA of initiator 3 of PCR; SEQ ID AT THE: 6 presents the sequence in DNA of initiator 4 of PCR; SEQ NC ID ): 7 presents the promoter sequence in gpd
and the Kozak sequence, the gpd promoter has residues: 1-870, the residues from the restriction enzyme sites: 871-882 and the
sequenceSEQ Kozak: residues: 883-892; ID AT THE: 8 presents the sequence in DNA of initiator 5 of PCR; SEQ ID AT THE: 9 presents the sequence in DNA of initiator 6 of PCR; SEQ NC ID i: 10 displays the amino acid sequence in
T. emersonii cellobiohydrolase I;
SEQ ID NO: 11 shows the coding sequence for
CBHI of T. emersonii (DNA, coding region) of 06/04/2018, p. 29/244
12/147
SEQ ID NO: 12 shows the amino acid sequence of T. emersonii β-glucanase CEA (protein);
SEQ ID NO: 13 shows the CEA coding sequence (DNA, coding region) for T β-glucanase.
emersonii
SEQ ID NO: 14 shows the amino acid sequence of T. emersonii β-glucosidase (protein)
SEQ ID NO: 15 shows the T. emersonii β-glucosidase coding sequence (DNA, coding region)
SEQ ID NO: 16 shows the amino acid sequence of T. emersonii cellobiohydrolase II (protein)
SEQ ID NO: 17 shows the coding sequence for T. emersonii cellobiohydrolase I (DNA, coding region), wild-type sequence.
SEQ ID NO: 18 shows the amino acid sequence of an unknown protein from T. emersonii having
209 amino acids.
SEQ ID NO: 19 shows the coding sequence for an unknown protein from T. emersonii having an amino acid sequence according to SEQ ID NO: 18.
SEQ ID NO: 20 features the sequence in amino acids in swolenina of T. emersonii. SEQ ID NO: 21 features the sequence in coding in swolenina of T. emersonii. SEQ ID NO: 22 features the sequence in amino acids in T. acetyl xylan esterase. emersonii. SEQ ID NO: 23 features the sequence in coding in T. acetyl xylan esterase. emersonii. SEQ ID NO: 24 features the sequence in amino acids gives
T. emersonii xylanase.
of 06/04/2018, p. 30/244
12/15
SEQ ID NO: 25 shows the T. emersonii xylanase coding sequence.
Detailed description of the invention
Throughout this report and in the appended claims, the words understand and include and their inflections such as understand, understand, include and including should be interpreted as being inclusive. That is, these words are intended to indicate the possible inclusion of other elements or integers not specifically cited, whenever the context allows.
Articles one and one are used in this document to refer to one or more of one (that is, one or at least one) of the article's grammatical complement. For example, an element can mean an element or more than one element.
In accordance with the present invention it has now been shown that the above transformation techniques can be used to obtain a high level of expression of heterologous polypeptides or to increase the production of homologous polypeptides in Talaromyces.
As used in the present, transformant means a cell that has been the object of the transformation.
Transformant and recombinant cell are used herein as synonyms.
Transformation in the present means the genetic alteration of a cell by means of recombinant technology. It can result in the absorption, incorporation and expression of genetic material (DNA, RNA or protein) or in the mutation or deletion of genetic material in the cell, through human intervention.
of 06/04/2018, p. 31/244
12/167
Nucleic acid construction: The term nucleic acid construction as used herein refers to a nucleic acid molecule, or a strand or two, that is isolated from a naturally occurring gene or that has been modified to contain segments of nucleic acids in a way that otherwise would not exist in nature. The term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains the control sequences necessary for the expression of a coding sequence of the present invention.
As used herein, the terms gene and recombinant gene refer to nucleic acid molecules that can be isolated from chromosomal DNA and that include an open reading frame encoding a polypeptide, such as cellulase, cellobiohydrolase, for example.
A gene can include coding sequences, non-intron coding sequences and / or regulatory sequences. In addition, the term gene can refer to an isolated nucleic acid molecule as defined herein.
As used herein, the term heterologous polypeptides means polypeptides not produced by Talaromyces whereas homologous polypeptides mean polypeptides produced by Talaromyces himself. The substrate (also called feed material) is used to refer to a substance comprising carbohydrate material, which can be treated with enzymes according to the invention, so that the carbohydrate material in it is modified. In addition to June 4, 2018, p. 32/244
17/127 carbohydrate material, the substrate may contain any other component, including, but not limited to, non-carbohydrate and starch material. The carbohydrate in this context includes saccharides, polysaccharides, oligosaccharides, disaccharides or monosaccharides, for example. Cellulase inducer is at present defined as a compound that induces cellulase production in Talaromyces. Examples of cellulase inducers are pure cellulose cellulose, sophorosis and gentiobiosis or any lignocellulosic material.
A polypeptide according to the present invention can modify a carbohydrate material by chemically or physically modifying that material, chemical modification of the carbohydrate material can result in the degradation of such material, by hydrolysis, oxidation or other modification, for example, as by the action of a lyse. Physical modification may or may not be accompanied by chemical modification.
The different embodiments of the invention are described in more detail below.
Talaromyces transformants
The invention proposes Talaromyces transformants. Talaromyces transformants are prepared by transforming a Talaromyces host, such as Talaromyces emersonii, with recombinantly introduced DNA. As indicated above, the invention proposes a Talaromyces transformant capable of producing cellulase in the absence of a cellulase inducer in a glucose medium, having a cellulase activity of 2 WSU / ml or more in supernatant or broth diluted 16 times or in one of 06/04/2018, p. 33/244
18/127 supernatant or broth even more diluted, in another mode 5 WSU / mL or more in supernatant or broth diluted 16 times or in supernatant or broth further diluted. In another embodiment, the Talaromyces transformant has a cellulase activity of 2 or more WSU / mL in supernatant or broth diluted 16 to 10,000 times, 3 or more WSU in a supernatant or diluted broth from 16 to
5000 times, 3 or more WSU / mL in a supernatant or broth diluted 16 to 2500 times.
In one embodiment, the Talaromyces transformant has an endoglucanase activity of 50 WBCU / mL or more.
In one embodiment, the Talaromyces transformant has a total cellulase content as determined by APEX of 38% or more, 39% or more, 40% or more, 41% or more, 42% or more, 43% or more, 44 % or more, 45% or more, 46% or more, 47% or more and / or 48% or more.
In another embodiment, the Talaromyces transformants according to any one of claims 1 to 4, containing two or more recombinant genes capable of expressing cellulase. Talaromyces transformants according to the present invention, wherein the two or more genes capable of expressing cellulase include the cellobiohydrolase, endoglucanase and / or beta-glucosidase gene.
The invention also includes a modality of a Talaromyces transformant in which the cellobiohydrolase gene is cellobiohydrolasee (and / or cellobiohydrolase II. In one embodiment, in the Talaromyces transformant one or more genes are integrated into the Talaromyces genome. The Talaromyces transformant is marker-free in another mode.
of 06/04/2018, p. 34/244
12/197
Host cells
The host cells used in accordance with the invention are cells of the genus Talaromyces. It is preferable that the Talaromyces host is one of Talaromyces emersonii, Talaromyces stipitaus, Talaromyces marxianus or Talaromyces flavus. In one embodiment, the host is Talaromyces emersonii, such as ATCC16479 from Talaromyces emersonii, for example.
Transformation
Host transformation can be conducted by any suitable known method including, for example, electroporation, particle bombardment or microprojectile bombardment, protoplast methods and Agrobacterium-mediated transformation (AMT). It is preferable to use the protoplast method. The procedures for transformation are described by J.R.S. Fincham, Transformation in fungi. 1989, microbiological reviews. 53,
148-170.
To obtain transformants using the protoplast method, the transformation protocol has to be optimized. For the generation of protoplasts, the mycelium is collected from cultures grown for 8 to 72 hours, preferably 14 to 24 hours. The mycelium is resuspended in a buffer containing an osmotic stabilizer in a lytic enzyme preparation. An osmotic stabilizer can be selected from the group that includes, but is not limited to, sucrose, sorbitol, mannitol, KC1, NH4CI, NaCl, MgSCU and NaCl, preferably sucrose, sorbitol or KC1 at a concentration of 0.4-1.4M, preferably from 0.8 to 1.2, with 1.0M being more preferable. Lytic enzyme preparations
Petition 870180047364, of 06/04/2018, p. 35/244
12/207 can be selected from the group that includes, but is not limited to, Glucanex 200G, Novozyme 234, Caylase C3, Zymolyase, and Driselase, preferably Glucanex 200G. Digestion can be conducted at a temperature between 30 ° C and 37 ° C on a rotary shaker for 1 to 3 hours. The protoplasts can be separated from the mycelium using a Miracloth filter, sintered glass filter, muslin, 30 pm screen, or a sorbitol pad, centrifugation and the mycelium is allowed to settle and the protoplasts are collected by decantation. After the protoplasts have been washed in buffer with osmotic stabilizer, 104 to 109 protoplasts are added to 0.1-40 pg of DNA and, optionally, a nuclease inhibitor, such as aurintricarboxylic acid, in a buffer containing an osmotic stabilizer. and 10-50 mM CaCl2, preferably 50 mM CaCl2. Optionally, the mixture is incubated for 15-30 minutes at 4 ° C or at room temperature. Polyethylene glycol (PEG4000, PEG6000 or PEG8000, preferably PEG4000) is added to the mixture with a final concentration of 6 to 55%. The addition of PEG can be done in steps in a sequence where the concentration of PEG is gradually increased. Between PEG additions the suspension is incubated for 5-30 minutes at 4 ° C-37 ° C. It is preferable to add 6% PEG400 (final concentration) to a suspension of protoplasts and DNA, incubated for 10 minutes at room temperature, and subsequently a second amount of PEG4000 is added to a final concentration of 51% followed by an incubation of 15 minutes at 25 ° C. An aliquot of the mixture is either added directly to soft agar and poured into selective regeneration plates, or the protoplasts of 06/04/2018, p. 36/244
12/21 are washed and disposed on selective regeneration plates. The soft agar contains the culture medium with an osmotic stabilizer with or without a selection marker and a low concentration of agar that allows the agar to be poured at 40 ° C - 60 ° C. The regeneration medium contains culture medium with an osmotic stabilizer which can be the same osmotic stabilizer used for the formation of protoplasts.
The polynucleotide can be DNA, RNA or protein. In the case of DNA, a vector is used with the promoter, the coding region and the terminator sequence, an element called an expression cassette. Using the desired polynucleotide sequence as a hybridization probe, nucleic acid molecules (i.e., genes) according to the invention can be isolated using standard hybridization and cloning techniques (as described, for example, in Sambroook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
A nucleic acid can be amplified using cDNA, mRNA or alternatively genomic DNA, as a template and suitable oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid thus amplified can be cloned into a suitable vector and characterized by analysis of the sequences of
DNA.
In addition, oligonucleotides that correspond to a nucleotide sequence or can be hybridized to it according to the present invention can be prepared from 06/04/2018, p. 37/244
22/127 by standard synthetic techniques, using, for example, an automated DNA synthesizer.
Depending on the desired functionality, the result of the transformation process according to the invention can be (heterologous) expression, over expression, controlled regulation and / or controlled deletion of specific genes. The polynucleotides or oligonucleotides of the present invention can be synthetic polynucleotides.
The introduction of genes into the host can be episomal, using a plasmid with the gene of interest, or the gene can be integrated into the host's genome during the transformation process into one or more copies. Corresponding expression constructs can be produced.
In one embodiment of the invention, the transformation process is conducted as a co-transformation, that is, a transformation with two or more types of recombinant DNA. Co-transformation can be performed, for example, with a) a vector containing a marker and b) a vector containing one or more genes of interest.
In one embodiment of the invention, the transformation can use libraries of DNA, genomic DNA, RNA, cDNA or proteins.
The transformation of the Talaromyces host is carried out with a selection marker. For the stable transformation of Talaromyces cells, we found that, depending on the expression vector and the transfection technique used, only a small fraction of the cells can integrate foreign DNA into their genome. To identify and select these members, a gene that encodes a marker from 06/04/2018, p. 38/244
23/127 are, for example, carbamoyltransferase), selection (antibiotic resistance, for example) is usually introduced into host cells along with the gene of interest. Suitable selection markers amdS, argB (ornithine bar (phosphinothricin acetyltransferase), carboxin resistance, hemA (5aminolevulinate), hemB (porphobilinogen synthase), ble (phleomycin resistance), hygB (hygromycin phosphotransferase), natR (resistance to nourseotricin) niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), DHFR, sC (adenyltransferase sulfate), trpC (anthranylate synthase), pyroA, riboB. Suitable for use in a Talaromyces cell are the amdS gene (EP 635574 Bl, WO 97/06261), the ble gene (Mattern, IE, Punt, PJ, Van den Hondel, CAMJJ, 1988. The Aspergillus transformation conferring phleomycin resistance vector. Fungai Genet. Newsl. 35, 25), and the hygB gene (Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CAMJJ, 1987. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gen. 56: 1 17-24). modality, an amdS gene such as an amd gene is used S, for example, comes from A. nidulans or A. niger. In one embodiment, the selection marker gene is the A. nidulans amdS coding sequence fused to the A. nidulans gpdA promoter (see EP 635574 Bl). The amdS genes from other filamentous fungi can also be used (WO 97/06261).
More specifically, it has been demonstrated that the selection of Talaromyces strains transformed with DNA encoding a polypeptide is possible through the use of the marker genes of 06/04/2018, p. 39/244
24/127 used for the transformation of A. niger. Due to the phylogenetic distance between the latter fungus and Talaromyces this could not be predicted.
In one embodiment, the transformation can be carried out more than once, that is, a transformed strain can be transformed again, once, two or more times. In one embodiment, the host for transformation into a second transformation is the Talaromyces transformant isolated from a first transformation and similarly, a preceding strain is the Talaromyces host for subsequent transformation into multiple transformations. In one embodiment, another marker can be used in one or more different stages of transformation, the use of phleomycin and hygromycin, for example, as different markers. Strains resulting from multiple transformations are referred to herein as multiple transformants. Consequently, in one embodiment, the invention relates to a process for the production of a multiple Talaromyces transformant, in which a Talaromyces transformant isolated in a first transformation is used as a host Talaromyces and is transformed into a second transformation and in the step ( e) from the second transformation the Talaromyces multiple transformant is isolated.
In one embodiment, a different selection marker is used in the first transformation than the one used in the second transformation, using, for example, phyomycin and hygromycin as the different markers.
In one embodiment, the selection marker is deleted from the transformed host cell after the introduction of the expression construct in order to obtain cells from 6/4/2018, p. 40/244
25/127 transformed hosts capable of producing the polypeptide that are free of selection marker genes, that is, free of marker. Such an approach is described in EP 0 635 574 and can be used in the invention. In multiple transformations as described above with it, the use of different markers can be avoided.
Vector
The polynucleotides of the invention can be incorporated into a recombinant replicable vector, a cloning or expression vector, for example. The vector can be used to replicate the nucleic acid in a compatible host cell. Thus, in another embodiment, the invention proposes a method of preparing polynucleotides of the present invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell and culturing the host cell under conditions that produce replication. of the vector. The vector can be recovered from the host cell. Suitable host cells are described below.
Therefore, another aspect of the invention relates to vectors, including cloning and expression vectors, comprising a polynucleotide of the invention that encodes a polypeptide or a functional equivalent thereof and methods of culturing, transforming or transfecting such vectors into a suitable host cell. , under conditions, for example, in which expression of a polypeptide of the invention occurs. As used herein, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been attached.
The vectors can be used in vitro, for the production of 06/04/2018, p. 41/244
26/127 RNA, for example, or used to transfect or transform a host cell.
The vector may further include sequences that flank the polynucleotide comprising sequences homologous to eukaryotic genomic sequences or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of a host cell.
The vector system can consist of a single vector, such as a single plasmid, or two or more vectors, such as two or more plasmids, which together contain the total DNA to be introduced into the host cell genome.
The vector into which the expression cassette or polynucleotide of the invention is inserted can be any vector that can be conveniently subjected to recombinant DNA procedures and the choice of the vector will often depend on the host cell into which it is to be introduced.
A vector according to the invention can be an autonomously replicating vector, that is, a vector that exists in the form of an extra-chromosomal entity, the replication of which is independent of chromosomal replication, such as a plasmid. Alternatively, the vector can be one that, when introduced into a host cell, integrates into the genome of the host cell and is replicated together with the chromosome (s) to which it has been integrated.
One type of vector is a plasmid that refers to a circular two-stranded DNA loop into which additional segments of DNA can be ligated. Another type of vector is the viral vector, with segments from 6/4/2018, p. 42/244
Additional 27/127 of DNA to be linked to the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (bacterial vectors, for example, which have a bacterial origin of replication and episomal mammalian vectors). Other vectors (such as non-episomal mammalian vectors, for example) are interacted with the genome of a host cell after its introduction into the host cell, and thus replicate together with the host's genome. In addition, certain vectors are able to direct the expression of genes to which they are operationally linked. These vectors are referred to here as expression vectors. In general, expression vectors of utility in recombinant DNA techniques are often found in the form of plasmids. The terms plasmid and vector can be used interchangeably in this document, since the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as cosmids, viral vectors (retroviruses, adenoviruses and viruses associated with defective replication adeno, for example) and phage vectors that perform equivalent functions.
The vectors according to the invention can be used in vitro, for the production of RNA, for example, or be used to transfect or transform a host cell.
The expression vector or construct is preferably integrated into the host cell genome to obtain stable transformants. In another of 06/04/2018, p. 43/244
28/127 modality, the vector or the expression construct is a minichromosome or an artificial chromosome. An autonomously maintained cloning vector can comprise the AMAI sequence (see Aleksenko and Clutterbuck (1997), Fungai Genet. Biol. 21: 373-397). In the case where the expression constructs are interacted with the host cell genome, the constructs are either integrated into random loci in the genome, or into predetermined target loci using homologous recombination, in which case the target loci preferably comprise , an extremely expressed gene.
A vector of the present invention can comprise two or more, three, four or five, for example, polynucleotides of the invention, for overexpression, for example.
The recombinant expression vectors of the present invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory sequences, selected based on the host cells to be used for expression, which is operationally linked to the nucleic acid sequence to be expressed.
Within a vector, such as an expression vector, operably linked means that the nucleotide sequence of interest is linked to the regulatory sequence (s) in a way that allows expression of the nucleotide sequence (in a system of transcription / translation in vitro, for example, or in a host cell when the vector is introduced into the host cell), that is, the term operationally linked from 06/04/2018, p. 44/244
29/127 refers to a juxtaposition in which the components described are in a relationship that allows them to function in their predestined way. A regulatory sequence such as that of a promoter, enhancer or other expression regulation signal operably linked to a coding sequence is positioned in such a way that the expression of the coding sequence is obtained under conditions compatible with the control sequences or else sequences are arranged in such a way that they work together for their intended purpose, transcription begins, for example, at a promoter, and proceeds through the DNA sequence encoding the polypeptide.
A vector or expression construct for a given host cell can thus comprise the following elements operably linked together in a constructive order starting from the 5 'end and to the 3' end with respect to the coding strand of the sequence encoding the polypeptide of the first invention: (1) a promoter sequence capable of directing the transcription of the nucleotide sequence that encodes the polypeptide in the given host cell; the translation initiation sequence including Kozak (see W02006 / 077258) (2) optionally, a signal sequence capable of directing secretion of the polypeptide from the host cell and into a culture medium; optionally, a pre-pro-sequence for efficient secretion (3) a DNA sequence of the invention encoding a mature and preferably active form of a polypeptide that has cellulase activity and, preferably, also (4) a termination region transcription (terminator) able to finish the transcription on 06/04/2018, p. 45/244
30/127 downstream of the nucleotide sequence encoding the polypeptide. See also W02006 / 07725 optimal translation termination signal. This also includes a polyadenylation signal for generation of poly A + mRNA. The control sequence can also be a polyadenylation sequence, a sequence that is operably linked to the 3 'terminal of the nucleic acid sequence and that, when transcribed, is recognized by the filamentous fungus cell as a signal to add polyadenosine residues to the transcribed mRNA . Any polyadenylation sequence that is functional in the cell can be used in the present invention. The optional polyadenylation sequences for filamentous fungi cells are obtained from the genes encoding A. oryzae TAKA amylase. glycoamylase from A. niger, anthranylate synthase from A. nidulans, trypsin-like protease from Fusarium oxysporum and alpha-flicosidase from A niger. The control sequence can also be a suitable transcription terminator sequence, a sequence recognized by a filamentous fungus cell to terminate transcription. The terminator sequence is operably linked to the 3 'terminus of the nucleic acid sequence encoding the polypeptide. Any terminator that is functional in the cell can be used in the present invention.
The optional terminator cells for filamentous fungi cells are obtained from the genes encoding A. oryzae TAKA amylase, A. niger glycoamylase (glaA), A. nidulans anthranilate synthase, A. niger alpha-glycosidase, trpC gene and trypsin-like protease from Fusarium oxysporum.
of 06/04/2018, p. 46/244
12/31
Downstream of the nucleotide sequence according to the invention there may be a 3 'untranslated region containing one or more transcription termination sites (a terminator, for example). The origin of the terminator is less critical. The terminator may, for example, be native to the DNA sequence encoding the polypeptide. It is preferable that the filamentous fungus terminator is used in
And more to the cell host cells of filamentous fungi it is preferable that the terminator is endogenous host (in which the nucleotide sequence encoding the polypeptide must be expressed).
In the transcribed region, a ribosome binding site for translation may be present. The coding portion of the mature transcripts expressed by the constructs will include a translation initiation AUG at the beginning and a termination codon properly positioned at the end of the polypeptide to be translated. See also comments on Kozak and interruption according to W02006 / 07725).
The term promoter is defined in the present invention as a DNA sequence that binds to RNA polymerase and directs the polymerase to the correct transcriptional start site downstream of the nucleic acid sequence encoding a biological compound to initiate transcription. RNA polymerase effectively catalyzes the assembly of the messenger RNA complementary to the appropriate DNA strand of a coding region. It will also be understood that the term promoter will include the 5 'non-coding region (between the promoter and the start of translation) for translation after transcription in mRNA, cis-acting transcription control elements such as those of 06/04/2018 , p. 47/244
32/127 enhancers and other nucleotide sequences capable of interacting with transcription factors. The promoter can consist of any promoter sequence suitable for a eukaryotic or prokaryotic host cell, which exhibits transcriptional activity, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, either homologous (native) or heterologous (foreign) to the cell. The promoter can be a constitutive or inducible promoter. Examples of inducible promoters that can be used are promoters inducible by starch, copper, oleic acid. The promoter can be selected from the group that includes, but is not limited to, promoters obtained from the genes encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral alphaamylase, A. niger acid-stable alpha-amylase , A. awamori glycoamylase (glaA), R. miehei lipase, A. oryzae alkaline protease, A. oryzae triose isomerase phosphate, A. nidulans acetamidase, the NA2-tpi promoter (a hybrid of promoters from the genes encoding A. niger neutral alpha-amylase, and A. oryzae isomerase triose phosphate), promoters obtained from genes encoding cbhl, cbh2, egl, eg2, eg3, eg5, eg6, xinl, xin2 or xyll, and mutant, truncated and hybrid promoters of them. In one embodiment, the promoter is selected from the promoter of the DNA sequence encoding the polypeptide and a heterologous promoter selected from the group consisting of glaA promoters from A. niger, cbhl from T. emersonii, and bg from T. emersonii , or functional parts thereof optionally preceded by 04/06/2018, p. 48/244
33/127 epissomais and derivatives of upstream activator sequences.
In another embodiment, the promoters for use in filamentous fungus cells are a promoter, or a functional part thereof, derived from a protease gene; such as a trypsin-like protease gene from Fusarium oxysporum (US 4,288,627), A. oryzae alkaline protease (alp) gene, A. niger pacA gene, A. oryzae alkaline protease gene, gene neutral A. metalloprotease, A. niger pepA aspergillopepsin protease gene, or F. venenatum trypsin gene, A. niger pepB protease aspartic gene. Other promoters are the promoters described in W02006 / 092396 and W02005 / 100573, which are incorporated by reference in this document.
The use of multiple promoters in a single strain is described in WO 2008/098933. The teachings of WO 2008/098933 can be applied to the present invention.
It will be noted by those skilled in the art that the design of the expression vector may depend on such factors as the level of expression of the desired polypeptide, etc. The vectors, such as expression vectors, of the invention can be introduced into host cells to thereby produce polypeptides or peptides, encoded by nucleic acids as described herein (polypeptides, mutant forms of polypeptides, fragments, variants or their functional equivalent, for example) example). Consequently, expression vectors useful in the present invention include chromosomal vectors derived from viruses, such as bacterial, bacteriophage plasmid vectors, from 06/04/2018, p. 49/244
34/127 yeast episomes, yeast chromosomal elements, viruses such as baculovirus, papova virus, Vaccinia virus, adenovirus, fowl pox virus, pseudohydrophobia and retrovirus viruses, and vectors derived from their combinations such as those derived from elements plasmid and bacteriophage genes, such as cosmids and phagemids. In accordance with the present invention, the culture medium is used in the manner described in the present document in the examples and in the culture conditions as described in the examples or in an alternative medium and in culture conditions which have an analogous performance.
Integration
According to an embodiment of the present invention, integration is achieved. In such a modality, an integrative cloning vector can integrate randomly or else to a predetermined target locus of the host cell chromosome (s) to which it must be integrated. In an embodiment of the invention, an integrative cloning vector can comprise a DNA fragment that is homologous to a DNA sequence at a predetermined target locus in the host cell's genome, to target the integration of the cloning vector into this predetermined locus . To promote targeted integration, the cloning vector can preferably be linearized before the transformation of the host cell. The linearization can preferably be conducted in such a way that at least one end, but preferably both of the cloning vector are flanked by sequences homologous to the target locus. The length of the homologous sequences that flank the target locus is at least approximately 0.1 kb, as of 06/04/2018, p. 50/244
35/127 at least approximately 0.2 kb, more preferably at least approximately 0.5 kb, even more preferable that it be at least approximately 1 kb, most preferably at least approximately 2 kb. It is preferable that the host strain strains can be modified to an increased frequency of target DNA integration as described in WO 05/095624 and / or WO2007 / 115886.
It is preferable that the efficiency of integration directed towards the host cell genome, i.e., integration into a predetermined target locus, is increased by the increased homologous recombination capabilities of the host cell. Such a cell phenotype preferably involves a defective hdfA or hdfB gene, as described in WO 05/095624. WO 05/095624 describes a method for obtaining a filamentous fungus cell that comprises an increased efficiency of targeted integration.
0 vector can oriented in an production in RNA
The vector may contain a polynucleotide of the invention with antisense direction to provide antisense. Synthetic polynucleotides can be optimized using codons, preferably according to the methods described in W02006 / 077258 and / or PCT / EP2007 / 055943, which are incorporated by reference in this document. PCT / EP2007 / 055943 is aimed at the optimization of the codon pair. Codon pair optimization is a method in which the nucleotide sequences encoding the polypeptide have been modified with respect to their use of codons. More specifically, the codon pairs that are used to obtain a greater expression of the nucleotide sequence than on 06/04/2018, p. 51/244
36/127 encodes the polypeptide and / or increased production of the encoded polypeptide. Codon pairs are defined as sets of two subsequent triplets (codons) in a coding sequence.
Construction modalities
When the polypeptide according to the invention is to be secreted from the host cell into the culture medium, a suitable signal sequence can be added to the polypeptide to direct the newly synthesized polypeptide to the host cell's secretion pathway. Those skilled in the art go out how to select a signal sequence suitable for a specific host. The signal sequence may be native to the host cell or it may be foreign to the host cell. As an example, a signal sequence from a polypeptide native to the host cell can be used. It is preferred that the native polypeptide is an extremely secreted polypeptide, that is, a polypeptide that is secreted in amounts greater than 10% of the total amount of the polypeptide being secreted.
As an alternative to a signal sequence, the polypeptide of the invention can be fused to, or part of, a secreted carrier polypeptide. Such a chimeric construction is directed to the secretion pathway through the signal sequence of the carrier polypeptide can be any polypeptide. It is preferable that an extremely secreted polypeptide is used as a carrier polypeptide. The carrier polypeptide can be native or tin to the polypeptide according to the invention. The carrier polypeptide may be native or foreign to the host cell.
of 06/04/2018, p. 52/244
37/127
Examples of such carrier polypeptides are glycoamylase, alpha pairing factor pre-sequence, cellulose binding domain of Clostridium cellulovorans polypeptide A, glutathione Stransferase, chitin binding domain of chitinase Al from Bacillus circulans, maltose binding domain encoded by the E. coli K12 malE gene, beta galactosidase, and alkaline phosphatase. An optional carrier polypeptide for the expression of such a chimeric construct in Aspergillus cells is glycoamylase. The carrier polypeptide and the polypeptide according to the invention can contain a specific amino acid motif to facilitate isolation of the polypeptide; the polypeptide according to the invention can be released by a special release agent. The release agent can be a proteolytic enzyme or a chemical agent. An example of such an amino acid motif is the KEX protease dividing site, which is known to those skilled in the art.
A signal sequence can be used to facilitate the secretion and isolation of a polypeptide or polypeptide of the invention. Signal sequences are typically characterized by a nucleus of hydrophobic amino acids, which are generally cleaved from the mature polypeptide during secretion in one or more divage events. Such signal peptides contain processing sites that allow the signal sequence to divide from the mature polypeptides as they pass through the secretion pathway. The signal sequence directs the secretion of the polypeptide, such as that of a eukaryotic host in which the expression vector is from 06/04/2018, p. 53/244
38/127 transformed and the signal sequence is subsequently or simultaneously cleaved. The polypeptide can then be easily purified from the extracellular medium by known methods. Alternatively, the signal sequence can be linked to the polypeptide of interest using a sequence that facilitates purification such as one with a GST domain. Thus, the sequence encoding the polypeptide can be fused, for example, to a marker sequence, such as a sequence encoding a peptide, which facilitates the purification of the fused polypeptide. In certain embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, such as the identifier provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Know. USA 82: 821-824 (1989), for example, hexa histidine provides convenient purification of the fusion polypeptide. The HA identifier is another peptide useful for purification and which corresponds to an epitope derived from the influenza hemagglutinin polypeptide, which has been described by Wilson et al., Cell 37: 767 (1984), for example.
In general, the transformant can be constructed by reducing or eliminating expression of certain genes.
The reduction or elimination of these genes can be an advantage, since it can increase the yield of desirable polypeptides and can also reduce the decomposition of desirable polypeptides under the influence of polypeptide expressed by the reduced or deleted gene. The reduction or deletion can be done using one or more of 06/04/2018, p. 54/244
39/127 methods well known in the art, insertions, destructions, substitutions or deletions, for example. The methods for reduction or deletion can be site-directed or random mutagenesis methods. The portion of the gene to be modified or inactivated can be, for example, the coding region or a regulatory element necessary for the expression of the coding region. An example of such a gene regulatory or control sequence may be a promoter sequence or a functional part thereof, that is, a part that is sufficient to affect the expression of the gene. Other control sequences for possible modification include, but are not limited to, a leader, a polypeptide sequence, pre-pro-peptide, Kozak, signal sequence transcription start, transcription terminator, transcriptional activator, translational initiation site and translational termination site.
In one embodiment, the polynucleotides of the present invention as described herein can be overexpressed in a microbial strain of the invention compared to the parent microbial strain in which the gene is not overexpressed. The overexpression of a polynucleotide sequence is defined herein as the expression of the sequence gene that results in an activity of the enzyme encoded by the sequence in a microbial strain being at least 1.2 times greater than that of the enzyme in the parent microbial strain; at least 1.5 times greater than this activity, preferably the activity of the enzyme at least approximately 2 times, at least approximately 3 times, at least approximately 4 times, at least approximately 5 of 06/04/2018, p. . 55/244
40/127 times, at least approximately 10 times, at least approximately 20 times, at least approximately 50 times, at least approximately 100 times, at least approximately 200 times, at least approximately 500 times, at least approximately 1000 times greater than the enzyme activity in the microbial parent strain.
In one embodiment, a fusion polypeptide can be produced. DNA fragments encoding different polypeptide sequences, for example, are linked together in a matrix according to conventional techniques, employing blunt-ended or stepped terminals for ligation, restriction enzyme digestion to provide the appropriate terminals, cohesive ends as appropriate alkaline phosphatase treatment to prevent undesirable binding and enzymatic binding. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be conducted using anchor primers to give complementary pendants between two consecutive gene fragments that can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, for example, Currnet Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). In addition, many expression vectors encoding a fusion fraction (such as a GST polypeptide, for example) are already commercially available. An encoding nucleic acid can be cloned into such an expression vector that the fusion fraction is linked from 06/04/2018, p. 56/244
41/127 in matrix to the polypeptide in such a way that the fused polypeptides are in matrix and the expression of the fused polypeptide is under the control of the same promoter (s) and terminator. The hybrid polypeptides can comprise a combination of complete or partial polypeptide sequences obtained from at least two different polypeptides in which one or more can be heterologous to the host cell.
Polypeptide expression / production
According to the invention, the polypeptide is expressed by the Talaromyces transformant. The Talaromyces transformant can thus be used in the preparation of a polypeptide according to the invention. Such a method comprises culturing a host cell (transformed as described above, for example) under conditions such as to provide for the expression of a coding sequence encoding the polypeptide and optionally recovering the expressed polypeptide.
Within the context of the present invention, the term recombinant refers to any genetic modification that does not exclusively involve naturally occurring processes and / or induced genetic modifications by subjecting the host cell to random mutagenesis, but also genetic destruction and / or deletions and / or specific mutagenesis, for example. Consequently, combinations of recombinant and naturally occurring processes and / or induced genetic modifications are considered to be recombinant by subjecting the host cell to random mutagenesis.
Recombinant Talaromyces cells from 06/04/2018, p. 57/244
42/127 (transformants) according to the invention can be cultured using procedures known in the art. For each combination of a promoter and a host cell, culture conditions are available that lead to the expression of the DNA sequence encoding the polypeptide. After the desired cell density or the desired polypeptide titer has been reached, the culture is stopped and the polypeptide is recovered using known procedures.
The fermentation medium can comprise a culture medium containing a carbon source (glucose, maltose, molasses, starch, cellulose, xylan, hydrolyzed lignocellulolytic biomass pectin, for example, etc.), a source of nitrogen (ammonium sulfate , ammonium nitrate, ammonium chloride, for example, etc.) and sources of inorganic nutrients (phosphate, magnesium, potassium, zinc, iron, for example, etc.). Optionally, an inducer (cellulose, pectin, xylan, maltose, maltodextrin or xylogalacturonan, for example) can be included.
The selection of the appropriate medium can be based on the choice of the expression host and / or based on the regulatory requirements of expression construction. Such means are known to those skilled in the art. The medium may contain, if desired, additional components that favor expression hosts transformed against other potentially contaminating microorganisms.
Fermentation can be conducted for a period ranging from approximately 0.5 to approximately 30 days. It can be a batch process, batch feed or continuous, suitably at a temperature that from 06/04/2018, p. 58/244
43/127 ranges from approximately 20 to approximately 90 ° C, for example, preferably from 20 to 55 ° C, more preferably from 40 to 50 ° C and / or at a pH of approximately 2 to approximately approximately
After stopping the removal of cells, the
8, for example, preferably from 3 to 5. Suitable conditions are generally selected based on the choice of the expression host and the polypeptide to be expressed.
After fermentation, if necessary, cells can be removed from the fermentation broth by means of centrifugation or filtration.
fermentation or after the polypeptide of the invention can then be recovered and, if desired, purified and isolated by conventional means. Polypeptide / Polypeptide compositions
The invention proposes a polypeptide or polypeptide composition that comprises a cellulase and / or a hemicellulase and / or a pectinase.
In the present document, a cellulase is any polypeptide that is capable of degrading or modifying cellulase and / or glucans. A polypeptide that is able to degrade cellulose is one that is able to catalyze the process of breaking down cellulose into smaller units, or partially, into cellodextrins, for example, or completely into glucose monomers. A cellulase according to the present invention can give rise to a population of cellodextrins and glucose monomers when it comes in contact with cellulose. Such degradation will typically occur through a hydrolysis reaction.
In this document, a hemicellulase is a polypeptide that is capable of degrading or modifying that of 06/04/2018, p. 59/244
44/127 hemicellulose. This means that a hemicellulase may be able to degrade or modify one or more of xylan, araban, glucuronoxylan, arabinogalactan, arabinoxylan, glucomannan, galactomannan and xyloglucan. A polypeptide that is able to degrade a hemicellulose is one that is able to catalyze the process of decomposing hemicellulose into smaller polysaccharides, partially into oligosaccharides, for example, or completely into sugar monomers, such as, for example, hexose monomers and pentose. A hemicellulase according to the invention can give rise to a mixed population of oligosaccharides and sugar monomers when placed in contact with the hemicellulase. Such degradation will typically occur through a hydrolysis reaction.
In this document, a pectinase is any polypeptide that is capable of degrading or modifying the pectin. A polypeptide that is able to degrade pectin is one that is able to catalyze the process of breaking down pectin into smaller units, either partially, in oligosaccharides, for example, or completely in sugar monomers. A pectinase according to the invention can give rise to a mixed population of oligosaccharides and sugar monomers when placed in contact with the pectinase. Such degradation will typically occur through a hydrolysis reaction.
Accordingly, a composition of the invention can comprise any cellulase, cellobiohydrolase, endo-β-Ι, 4-glucanase, β-glycosidase or β (1,3) (1,4) -glucanase.
In this document, a cellobiohydrolase (EC of June 4, 2018, page 60/244
45/127
3.2.1.91) is any polypeptide that is capable of catalyzing the hydrolysis of 1,4-pD-glycosidic bonds in cellulose or cellotetraose, releasing cellobiosis from the non-reducing ends of the chains., This enzyme can also be called cellulase 1,4 -p-cellobiosidase, 1,4-βcelobiohydrolase, 1,4-pD-glucan-cellobiohydrolase, avicelase, exo-1,4-pd-glucanase, exocelobiohydrolase or exoglucanase.
In the present document, an endo-β-Ι, 4-glucanase (EC 3.2.1.4) is any polypeptide that is capable of catalyzing the endohydrolysis of 1,4 ^ -D-glycosidic bonds in cellulose, lichenine or β-Dp- glucans from cereals. Such a polypeptide may also be able to hydrolyze 1,4 bonds in βD-glucans which also contain 1,3 bonds. This enzyme can also be called cellulase, avicelase, β-1,4endoglucan hydrolase, β-1,4,4-glucanase, carbosimethyl cellulases, celludextrinase, endo-1,4 ^ -D-glucanase, endo1,4 ^ -D-glucanohydrolase, endo-1,4 ^ -glucanase or endoglucanase.
In the present document, a β-glycosidase (EC
3.2.1.21) is any polypeptide that is able to catalyze the hydrolysis of non-reducing terminal residues of β-D-glucose with the release of β-D-glucose. Such a polypeptide can have a broad specificity for β-D-glycosides and can also hydrolyze one or more of the following: a β-D galactoside, an α-L-arabinoside, a β-D-xyloside or a β-D-fucoside. This enzyme can also be called tonsillase, β-D-glycoside glycohydrolase, celobiase or gentobiase.
In this document, a β- (1,3) (1,4) -glucanase of 06/04/2018, p. 61/244
46/127 (EC3.2.1.73) is any polypeptide that is capable of catalyzing the hydrolysis of 1,4-p-D-glycosidic bonds into β-D-glucans containing 1,3 and 1,4 bonds. Such a polypeptide can act on lichenin and on cereal β-Dglucans, but not on β-D-glucans that contain either only 1,3 or only 1,4 bonds. this enzyme can also be called licheninase, 1,3-1,4-β-ϋglucan 4-glucanohydrolase, β-glucanase, endo-β-Ι, 3-1,4glucanase, lichenase or β-glucanase of mixed bonds. An alternative to this type of enzyme is EC 3.2.1.6 which is described as endo-1,3 (4) -β-glucanase. This type of enzyme hydrolyzes 1,3 or 1,4 bonds in β-D-glucans when the glucose residue, whose reducing group is involved in the bond to be hydrolyzed, is itself substituted in C-3. Alternative names include endo-1,3 ^ -glucanase, laminarinase, 1,3- (1,3; 1,4) -β-D-glucan 3 (4) glucanohydrolase ;. substrates include laminarin, lichenine and cereal β-D-glucans.
A composition of the invention can comprise any hemicellulase, endoxylanase, β-xylosidase, α-Larabinofuranosidase, 1,4-D-arabinoxylan arabinofuranohydrolase, acetyl-xylan esterase, α-D-glucuronidase, cellobiohydrolase, feruloil esterase, cumaroyl esterase, an α-galactosidase, a βgalactosidase, a β-mannanase, or a β-mannosidase.
In the present document, an endoxylanase (EC 3.2.1.8) is any polypeptide that is capable of catalyzing the endo hydrolysis of 1,4 ^ -D-xylosidic bonds in xylans. This enzyme can also be known as endo-1,4-xylanase or 1,4-D-xylan xylanhydrolase. An alternative is EC of 06/04/2018, p. 62/244
47/127
3.2.1.136, a glucuronoarabinoxylan endoxylanase, an enzyme that is capable of hydrolyzing 1,4-xylosidic bonds in glucuronoarabinoxylans.
In this document, β-xylosidase (EC 3.2.1.37) is any polypeptide that is capable of catalyzing the hydrolysis of 1,4 ^ -D-xylans, to remove successive residues of Dxylose from the non-reducing terminals. Such enzymes can also hydrolyze xylobiosis. This enzyme may also be known as xylan 1,4-xylosidase, 1,4-D-xylan xylohydrolase, exo-1,4-xylosidase or xylobiase.
In the present document, an aL-arabinofuranosidase (EC 3.2.1.55) is any polypeptide that is capable of acting on α-L-arabinofuranosides, α-L-arabinans containing bonds (1,2) and / or (1,3) and / or (1,5), arabinoxylans and arabinogalactans. This enzyme can also be known as oi-N-arabinofuranosidase, arabinofuranosidase or arabinosidase.
In the present document, an α-D-glucuronidase (EC 3.2.1.139) is any polypeptide that is capable of catalyzing a reaction as follows: α-D-glucuronoside + H (2) O = an alcohol + D-glucuronate. This enzyme can also be known as α-glucuronidase or α-glycosiduronase. These enzymes can also hydrolyze 4-0- glucuronic acid, which can also be present as a substitute in xylans. An alternative is EC 3.2.1.131: xylan oi-1,2glycuronosidase, which catalyzes the hydrolysis of a1,2- (4-0-methyl) glucuronosyl bonds.
In the present document, a cellobiohydrolase (EC
3.1.1.72) is any polypeptide that is capable of catalyzing the deacetylation of xylans and xylooligosaccharides. As of 06/04/2018, p. 63/244
48/127 polypeptide can catalyze the hydrolysis of polymeric xylan acetyl groups, acetylated xylose, acetylated glucose, α-naphthyl acetate or p-nitrophenyl acetoa but, typically, not triacetylglycerol. Such a polypeptide typically does not act on acetylated mannan or acetylated pectin.
In this document, an acetyl-xylan esterase (EC 3.1.1.6) is any polypeptide that is capable of specifically hydrolyzing the ester bonds of acetyl groups at positions 2 and / or 3 of the natural xylan xylose fractions.
In this document, feruloyl esterase (EC
3.1.1.73) is any polypeptide that is capable of catalyzing a reaction in the form: feruloyl saccharide + H (2) O = ferulate + saccharide. The saccharide can be, for example, an oligosaccharide or a polysaccharide. It can typically catalyze the hydrolysis of the 4-hydroxy-3-methoxycinnamyl (feruloyl) group of a esterified sugar, which is generally arabinose on natural substrates, p-nitrophenol acetate and methyl ferulate are typically more precarious substrates. This enzyme can also be known as cinnamoyl ester hydrolase, ferulic acid esterase or hydroxycinnamyl esterase. It can also be known as an accessory enzyme of hemicellulase, since it can help xylanases and pectinases to break down hemicellulose and pectin in the cell wall of plants.
In the present document, a cumaroyl esterase (EC
3.1.1.73) is any polypeptide that is capable of catalyzing a reaction of the form: cumaroyl-saccharide + H (2) O = coumarate + saccharide. The saccharide can be, for example, an oligosaccharide or a polysaccharide. This enzyme may from 06/04/2018, p. 64/244
49/127 also be known as trans-4-cumaroyl esterase, transp-coumaroyl esterase, p-cumaroyl esterase or p-cumaric acid esterase. This enzyme also focuses on EC 3.1.1.73, so it can also be known as feruloyl esterase.
In the present document, an α-galactosidase (EC
3.2.1.22) is any polypeptide that is capable of catalyzing the hydrolysis of non-reducing terminal residues of α-Dgalactose into α-D-galactosides, including galactose oligosaccharides, galactomannans, galactans and arabinogalactans. Such a polypeptide may also be able to hydrolyze α-D-fucosides. This enzyme can also be known as melibiasis.
In the present document, a β-galactosidase (EC
3.2.1.23) is any polypeptide that is capable of catalyzing the hydrolysis of non-reducing terminal residues of β-Dgalactose to β-D-galactosides. Such a polypeptide may also be capable of hydrolysing i-L-arabinosides. This enzyme can also be known as exo- (l-> 4) -β-Dgalactanase or lactase.
In the present document, a β-mannanase (EC 3.2.1.78) is any polypeptide that is capable of catalyzing the random hydrolysis of 1,4-D-mannoside bonds in mannans, galactomannans and glucomannans. This enzyme can also be known as mannan endo-1,4-mannosidase or endo-1,4-mannanase.
In this document, β-mannosidase (EC 3.2.1.25) is any polypeptide that is capable of catalyzing the hydrolysis of terminal residues, not reducing β-D-mannose to β-Dmannosides. This enzyme may also be known as from 06/04/2018, p. 65/244
50/127 mannanase or mannase.
A composition of the present invention can comprise any pectinase, endo polygalacturonase, pectin methyl esterase, endo-galactanase, β-galactosidase, pectin acetyl esterase, endo-pectin lyase, pectate lyase, alpha ramnosidase, exo-galacturonase, an exo-polygalacturonate lyase, a ramnogalacturonan hydrolase, a ramnogalacturonan lyase, a ramnogalacturonan acetyl esterase, a ramnogalacturonan galacturonohydrolase or a xylogalacturonase.
In this document, an endo-polygalacturonase (EC 3.2.1.15) is any polypeptide that is capable of catalyzing the random hydrolysis of 1,4-o-D-galactosiduronic bonds in pectate and other galacturonans. This enzyme can also be known as polygalacturonase, pectin depolymerase, pectinase, endopoligalacturonase, pectolase, pectin hydrolase, pectin polygalacturonase, poly-a-1,4-galacturonide glycanhydrolase, endogalacturonase; endo-D-galacturonase or poly (1,4-hi-D-galacturonide) glycanhydrolase.
In this document, a pectin methyl esterase (EC 3.1.1.11) is any enzyme that is capable of catalyzing the reaction: pectin + η H2O = n methanol + pectate. The enzyme can also be known as pectinesterase, pectin demetoxylase, pectin methoxylase, pectin methylesterase, pectase, pectinesterase or pectin pectylhydrolase.
In this document, an endo-galactanase (EC 3.2.1.89) is any enzyme capable of catalyzing the endohydrolysis of 1,4-p-D-galactoside bonds in arabinogalactans. The enzyme may also be known as from 06/04/2018, p. 66/244
51/127 arabinogalactane galactanase, endo-1,4-p-galactosidase, endo-1,4-βgalactanase, arabinogalactanase or arabinogalactane 4-p-D-galactanohydrolase.
In the present document, a pectin acetyl esterase is defined herein as any enzyme that has an acetyl esterase activity that catalyzes the deacetylation of the acetyl groups in the hydroxyl groups of GalUA pectin residues
In this document, an endo-pectin lyase (EC 4.2.2.10) is any enzyme capable of catalyzing the eliminative divination of methyl (l-> 4) -α-D-galacturonane to produce oligosaccharides with 4-deoxy-6- groups O-methyl-aD-galact-4-enuronosyl at its non-reducing ends. The enzyme can also be known as pectin lyase, pectin trans-elimininase; endo-pectin lyase, polymethylgalacturonic transeliminase, methyltranseliminase pectin, pectolase, PL, PNL or PMGL or (l-> 4) -6-O-methyl-a-Dgalacturonane lyase.
In this document, a pectate lyase (EC 4.2.2.2) is any enzyme capable of catalyzing the eliminative divination of (l-> 4) -α-D-galacturonane to produce oligosaccharides with 4-deoxy-o-D-galact- groups 4-enuronosyl at its non-reducing ends. The enzyme can also be known as polygalacturonic transeliminase, pectic acid transeliminase, polygalacturonate liase, endopectin methyltranseliminase, transeliminase pectate, endogalacturonate transeliminase, pectic acid liasis, plexic lysis, lysis, plexis, lysis -N, endo-a-1,4-polygalacturonic acid lyase, acid lyase 06/04/2018, p. 67/244
52/127 polygalacturonic, pectin trans-elimininase, trans-elimininase of polygalacturonic acid or (l-> 4) -a-D-galacturonane lyase.
In this document, an α-ramnosidase (EC 3.2.1.40) is any polypeptide that is capable of catalyzing the hydrolysis of non-reducing terminal residues of α-L-rhamnose in a-Lramnosides or alternatively in ramnogalacturonane. This enzyme can also be known as α-L-ramnosidase T, α-L-ramnosidase N or α-L-ramnoside ramnohydrolase.
In this document, an exo-galacturonase (EC 3.2.1.82) is any polypeptide capable of hydrolyzing the pectic acid from the non-reducing end, releasing digalacturonate. The enzyme can also be known as apoli-a-galacturonosidase, exopoligalacturonosidase or exopoligalacturanosidase.
In this document, exo-galacturonase (EC 3.2.1.67) is any polypeptide capable of catalyzing: (1,4-α-D-galacturonide) _n + H2O = (1,4-αD-galacturonide) _n -i + D-galacturonate. The enzyme can also be known as galacturan 1,4-a-galacturonidase, exopoligalacturonase, poly (galacturonate) hydrolase, exo-D-galacturonase, exo-Dgalacturonanase, exopoli-D-galacturonase or poly (1,4-a-Dgalacturonide) galacturonohydrolase.
In this document, exo-polygalacturonate lyase (EC 4.2.2.9) is any polypeptide capable of catalyzing the eliminative cleavage of 4- (4-deoxy-aD-galact-4enuronosyl) -D-galacturonate from the pectate reducing end, that is, of deesterified pectin. This enzyme can be known as disaccharide lyase pectate, exo-lyase pectate, exopectic acid transeliminase, 06/04/2018 exopectate, p. 68/244
53/127 lyase, exopolygalacturonic acid trans-elimininase, PATE, exo-PATE, exo-PGL or disaccharide (1-> 4) -a-D-galacturonane reducing end lyase.
In the present document, a ramnogalacturonane hydrolase is any polypeptide that is capable of hydrolyzing the bond between galactosiluronic acid and ramnopyranosyl in endo mode in strictly alternating structures, consisting of the disaccharide [acid (1,2-o-L-ramnoil- (1 , 4) o-galactosiluronic].
In the present document, ramnogalacturonane lyase is any polypeptide that is capable of cleaving α-LRhap- (1-> 4) -o-D-GalpA bonds in an endo manner in β-elimination ramnogalacturonane.
In the present document, a ramnogalacturonane acetyl esterase is any polypeptide that catalyzes the deacetylation of the main chain of alternating residues of rhamnose and galacturonic acid in the ramnogalacturonane.
In the present document, a ramnogalacturonane galacturonohydrolase is any polypeptide that is capable of hydrolyzing the galacturonic acid of the non-reducing end of strictly alternating structures of ramnogalacturonane in an exo manner.
In the present document, xylogalacturonase is any polypeptide that acts on xylogalacturonane by cleaving the β-xylose-substituted galacturonic acid chain in an endo manner. This enzyme can also be known as xylogalacturonane hydrolase.
In this document, an a-L-arabinofuranosidase (EC 3.2.1.55) is any polypeptide that is capable of acting on the o-L-arabinofuranosides, α-L-arabinans containing from 06/04/2018, p. 69/244
54/127 bonds (1,2) and / or (1,3) and / or (1,5), arabinoxylans and arabinogalactans. This enzyme can also be known as oi-N-arabinofuranosidase, arabinofuranosidase or arabinosidase.
In the present document, endo-arabinanase (EC 3.2.1.99) is any polypeptide that is capable of catalyzing the endohydrolysis of 1,5-a-arabinofuranoside bonds in 1,5arabinanes. The enzyme can also be known as endoarabinase, endo-1,5-a-L-arabinosidase arabinane, endo-1,5α-L-arabinanase, endo-a-1,5-arabanase; endo-arabanase or 1,5-a-L-arabinane 1,5-a-L-arabinanohydrolase.
A composition of the invention will typically comprise at least one cellulase, and / or at least one hemicellulase and / or at least one pectinase, (one of which is a polypeptide according to the invention). A composition of the invention can comprise a cellobiohydrolase, an endoglucanase and / or a β-glycosidase. Such a composition may also comprise one or more hemicellulases and / or one or more pectinases.
One or more (two, three, four, for example, or all) of an amylase, a protease, a lipase, a ligninase, a hexosyltransferase or a glucuronidase can be present in a composition of the invention.
Protease includes enzymes that hydrolyze peptide bonds (peptidases), as well as enzymes that hydrolyze bonds between peptides and other fractions, such as sugars (glycopeptidases). characterized in EC 3.4 and
Many proteases are suitable for use in the invention incorporated by reference herein. Some specific types of proteases include June 4, 2018, p. 70/244
55/127 cysteine proteases including pepsin, papain and serine proteases including chymotrypsins, carboxypeptidases and metalloendopeptidases.
Lipase includes enzymes that hydrolyze lipids, fatty acids and acylglycerides, including phosphoglycerides, lipopolypeptides, diacylglycerols and the like. In plants, lipids are used as structural components to limit water losses and infection by pathogens. These lipids include waxes derived from fatty acids, as well as cutin and suberin.
Ligninase includes enzymes that can hydrolyze or decompose the polymer structure of lignin. Enzymes that can break down lignin include lignin peroxidases, manganese peroxidases, laccases and feruloyl esterases, and other enzymes described in the art known as depolymerizing or otherwise decomposing lignin polymers. Also included are enzymes capable of hydrolyzing bonds formed between hemicellulosic sugars (especially arabinose) and lignin. Ligninases include, but are not limited to, the following set of enzymes: lignin peroxidases (EC 1.11.1), manganese peroxidases (EC1.11.1.13), laccases (EC 1.10.3.2.) And feruloyl esterases (EC 3.1. 1.73).
Hexosyltransferase (2.4.1-) includes enzymes that are capable of transferring glycosyl groups, more specifically hexosyl groups. In addition to transferring a glycosyl group from a donor containing glycosyl to another compound containing glycosyl, the acceptor, enzymes can also transfer the glycosyl group to water as an acceptor. This reaction is also known as a 06/04/2018 reaction, p. 71/244
56/127 hydrolysis, rather than a transfer reaction. An example of a hexosyltransferase that can be used in the invention is a β-glucanosyltransferase. Such an enzyme may be able to catalyze the degradation of (1,3) (1,4) glucan and / or cellulose, and / or a cellulose degradation product.
Glycuronidase includes enzymes that catalyze the hydrolysis of a glucuronoside, such as, for example, βglycuronoside to produce an alcohol. Many glucuronidases have already been characterized and may be suitable for use in the invention, such as, for example, βglycuronidase (EC 3.2.1.31), hyalurono-glucuronidase (EC 3.2.1.36), glucuronosyl disulfoglycosamine glucuronidase (3.2.1.56), glycyrizinate β -glycuronidase (3.2.1.128) or aD-glucuronidase (EC 3.2.1.139).
A composition of the invention can comprise an expansin or an expansin-like polypeptide, such as a swolenin (see Saloheimo et al., Eur .. J. Biohem. .269, 4202-4211,, 2002) or a swolenin-like polypeptide.
Expansins are involved in loosening the cell wall structure during the growth of the plant cell. Expansins have been proposed to destroy the hydrogen bond between cellulose and other cell wall polysaccharides without having hydrolytic activity. In this way they are considered to allow the sliding of the cellulose fibers and the enlargement of the cell wall. Swolenina, an expansin-like polypeptide contains an N-terminal Carbohydrate Binding Module (CBD) Family 1 domain and an expansin-like domain at C-terminal. For the purposes of the present invention, one of 06/04/2018, p. 72/244
57/127 expansin-like polypeptide or a swolenin-like polypeptide can comprise either of these domains or both and / or can destroy the structure of cell membranes (such as destroying the cellulosic structure), optionally without producing detectable qds of reducing sugars.
Alternative polypeptides that may be present are chosen, for example, from the group of catalase, laccase, phenoloxidase, oxidase, oxidoreductases, cellulase, xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic polypeptides, aminopeptidase, carboxypeptidase, ribbons , lyase, pectinase and other pectinolytic enzymes, amylase, glycoamylase, α-galactosidase, βgalactosidase, a-glucosidase, β-glucosidase, mannosidase, isomerase, invertase, transferase, ribonuclease, chitinase, mutanase and deoxyribonease.
The invention also relates to compositions comprising one or more polypeptides according to the invention.
In one embodiment, the polypeptide of the invention is a hemicellulase, and the composition of the invention will typically comprise a cellulase and / or a pectinase in addition to the polypeptide of the invention.
In another embodiment, the polypeptide of the invention is a pectinase, and the composition of the invention will typically comprise a cellulase and / or a hemicellulase in addition to the polypeptide of the invention.
In another embodiment, the polypeptide of the invention is a cellulase, and the composition of the invention will typically comprise a hemicellulase and / or a pectinase in addition to that of 6/4/2018, p. 73/244
58/127 polypeptide of the invention.
In one embodiment, cellulase is one or more of CBH I, CBH II, EG or BG. The polypeptide can be an isolated cellulase and / or an isolated hemicellulase or an isolated pectinase or a mixture of cellulase and / or a hemicellulase and / or a pectinase and / or other polypeptides. in one embodiment, the polypeptide is a cellulase that is a mixture of two polypeptides selected from CBH I, CBH II, EG or
BG.
It is preferred that the cellulase is a mixture comprising CBH I, CBH II, EG or BG. A composition of the invention can comprise one, two or three classes of cellulase, one, two or all, for example, of an endo-1,4β-glycanase (EG), an exo-cellobiohydrolase (CBH) and a βglycosidase (BG) .
A dainvv composition can comprise a polypeptide that has the same enzyme activity, such as the same type of cellulase, hemicellulase and / or pectinase, for example, as that provided by a polypeptide of the invention.
A composition of the invention can comprise a polypeptide that has a different type of cellulase activity and / or hemicellulase activity and / or pectinase activity than that provided by a polypeptide of the invention. A composition of the invention may comprise a type of cellulase activity and / or hemicellulase activity and / or pectinase activity provided by a polypeptide of the invention and a second type of cellulase and / or hemicellulase activity and / or pectinase activity provided by a hemicellulase / pectinase of 06/04/2018, p. 74/244
Additional 59/127.
A composition of the invention can comprise the polypeptide product of a polypeptide that integrates cellulase, scapholdin or a scapholdin-like polypeptide, such as, for example, CipA or CipC from Clostridium thermocellum or Clostridium cellulolyticum, respectively.
The scapholdins and polypeptides that integrate with cellulose are integral multifunctional subunits that can organize cellulolytic subunits into a multi-enzyme complex. This is achieved by the interaction of two complementary domain classes, that is, a cohesion domain in schafoldin and a doquerin domain in each enzyme unit. The scapholdin subunit also has a cellulose binding module (CBM) that mediates the fixation of the cellulosome to its substrate. A scapholdin or polypeptide that integrates with cellulose for the purposes of the invention may comprise one or both of these domains.
In one embodiment, the polypeptide composition may comprise polypeptides that originate from other microorganisms that are not Talaromyces, such as CBH I from Trichoderma, CBH II from Trichoderma, BG from Trichoderma and / or EG from Trichoderma, β-D-glycoside glycohydrolase, endogalactanase , swolenina, Cipl, Cip2, Xylanase III, βxilosidase XylA, acetylxilano esterase, chitinase, βmanase.
A composition of the invention can comprise a cellulose-induced polypeptide or modulator polypeptide, as encoded by the cipl or cip2 gene, for example, or by similar genes from 6/4/2018, p. 75/244
60/127
Trichoderma reesei / Hypocrea jacorina (see Foreman et al., J. Biol. Chem. 278 (340. 31988-31997, 2003). The polypeptide product of these genes are bimodular polypeptides, which contain a cellulose-binding module and a domain whose function or activity cannot be related to known families of glycosyl hydrolase, however, the presence of a cellulose-binding module and the coregulation of the expression of these genes with cellulase components indicates activities that have not been previously recognized and that have a potential role degradation of biomass.
A composition of the invention can be composed of one member of each of the classes of polypeptides mentioned above, several members of a class of polypeptides or any combination of these classes of polypeptides.
A composition of the invention can be composed of polypeptides, enzymes, for example, from (1) commercial suppliers; (2) cloned genes that express polypeptides, enzymes, for example; (3) complex broth (such as that resulting from the growth of a microbial strain in culture medium, in which the strains secrete polypeptides and enzymes into the medium; (4) cell lysates from strains grown as in (3); and / or (5) plant material that expresses polypeptides, such as enzymes, for example Different polypeptides, enzymes, for example, in a composition of the invention can be obtained from different sources.
Use of polypeptides
Polypeptides and cmpspolypeptides according to that of 06/04/2018, p. 76/244
61/127
in one product in what the sugars are in fermentation, in go O product in
invention can be used in many different applications
They can be used, for example, to produce fermentable sugars. In one embodiment, they can be used in a process for saccharification of lignocellulosic material, in which the lignocellulosic material that has been optionally treated previously, is placed in contact with a Talaromyces transformant according to the invention or a cellulase, hemicellulase or pectinase according to the invention, in which one or more sugars are produced. Fermentable sugars can then, as part of a biofuel process, be converted to biogas or to ethanol, butanol, isobutanol, 2-butanol or other suitable substances. The invention thus relates to a process for the preparation of ethanol fermentation, for example, it is fermented with a microorganism preferably yeast, to produce fermentation.
Alternatively, polypeptides and their compositions can be used as an enzyme, in the production of food products, in detergent compositions in the paper and pulp industry and in antibacterial formulations, for example, in pharmaceutical products such as throat lozenges, toothpaste and mouthwashes. . Some of the uses will be illustrated in more detail below.
In the uses and methods described below, the components of the compositions described above can be supplied concomitantly (i.e., in the form of a single composition per se) or separately or in sequence.
The invention also relates to the use of the 06/04/2018 polypeptide, p. 77/244
62/127 according to the invention and to compositions comprising such an enzyme in industrial processes.
Despite the long experience obtained with these processes, the polypeptide according to the invention can have a number of significant advantages over enzymes currently used. Depending on the specific application, these advantages may include aspects such as lower production costs, greater specificity in relation to the substrate, reduced antigenicity, a smaller amount of undesirable side activities, higher yields when produced in a suitable microorganism, more suitable limits of pH and temperature, no inhibition by hydrophobic products derived from lignin or a lesser amount of product inhibition or, in the case of the food industry, a better taste or texture of a final product as well as food category and kosher aspects.
In principle, a polypeptide or composition of the invention can be used in any process that requires treatment of a material that comprises polysaccharide. Thus, a polypeptide or composition of the invention can be used in the treatment of polysaccharide material. In the present document, the polysaccharide material is a material that comprises or consists essentially of one or, more typically, more than one polysaccharide.
Typically, the plants and the material derived therefrom comprise significant amounts of non-starch polysaccharide material. consequently, a polypeptide of the invention can be used in the form of a plant or fungal material or a material derived therefrom.
of 06/04/2018, p. 78/244
63/127
Lignocellulose
Polypeptides can be used to advantage to degrade lignocellulosic material. The main polysacrides are cellulose (glucans), hemicelluloses (xylans, heteroxylans and xyloglucans). In addition, some hemicellulose may be present in the form of glucomannans in raw material derived from wood, for example. The enzymatic hydrolysis of these polysaccharides into soluble sugars, glucose, xylose, arabinose, galactose, fructose, mannose, rhamnose, ribose, D-galacturonic acid, for example, and other hexoses and pentoses occurs under the action of different enzymes that act together .
In addition, pectins and other pectic substances such as arabinans can make up a considerable proportion of the dry mass of cell walls typically coming from non-woody plant tissues (approximately a quarter to half of the dry mass may consist of pectins).
Cellulose is a linear polysaccharide composed of glucose residues linked by β-1,4 bonds. The linear nature of cellulosic fibers, as well as β-linked (as compared to a-linked) stoichiometry, generates structures more likely to interconnect with hydrogen bonds than the extremely branched α-starch structures. Thus cellulosic polymers are generally less soluble, and formal fibers bond more tightly than fibers found in starch.
Hemicellulose is a complex polymer and its composition often varies widely from one organism to another, and from one type of tissue to another. In general the of 06/04/2018, p. 79/244
64/127 main component of hemicellulose is xylose bound in β1.4, a pentose sugar. However, this xylose is often branched at 0-3 and / or 0-2 and can be replaced with bonds to arabinose, galactose, mannose, glucuronic acid, galacturonic acid or by esterification to acetic acid (by esterification of ferulic acid to arabinose) . Hemicellulose may also contain glucan, which is a general term for β-linked hexoses (such as β (1,3) (1,4) glucans and heteroglucans already mentioned) and additionally glucomannans (in which both glucose and mannose are present in the linear main structure linked together by β bonds).
Pectic substances include pectins, arabinans, galactans and arabinoalactane. Pectins are the most complex polysaccharides in the plant cell wall. They are constituted around an internal chain of D-galacturonic acid units linked in oí (1,4) interconnected to a certain extent with L-rhamnose. In any cell wall there are a series of structural units that fit this description and it has generally been considered that in a single pectic molecule, the internal chains of different structural units are continuous with each other.
The main types of the structural unit are: galacturonane (homogalacturonane), which can be replaced with methanol in the carboxyl group and with acetate in 02 and 03; ramnogalacturonane I (RGI) in which the units of galacturonic acid alternate with units of rhamnose carrying side chains of galactan bound in (1,4) and arabinan bound in (1,5). The arabinan side chains of 06/04/2018, p. 80/244
65/127 can be linked directly to rhamnose or indirectly through galactan chains; xylogalacturonane with simple units of xylosin no 03 of galacturonic acid (closely associated with RGI); and ramnogalacturonan II (RGIIO, a less important especially complex unit containing unusual sugars, such as, for example, apiosis. An RGII unit can contain two apiosyl residues which, under suitable ionic conditions, can reversibly form borate esters.
The composition, nature of the substitution and the degree of branching of hemicelluloses is very different in dicotyledonous plants (ie plants whose seeds have two cotyledons or embryonic leaves in the seeds such as beans, peanuts, almonds, peas, pods) compared to monocotyledonous plants (ie, plants that have a single cotyledon or embryonic leaf in the seed such as corn, wheat, rice, grasses, barley). In dicots, hemicellulose consists mainly of xyloglucans that are 1,4-β-linked glucose chains with 1,6-β-linked xylosyl side chains. In monocotyledons, including most grain crops, the main component of hemicellulose is heteroxylans. These are mainly composed of 1,4-β-linked xylose backbone polymers with 1,3-oi binding to arabinose, galactose, mannose and glucuronic acid, or 4-0-methyl-glucuronic acid as well as modified xylose by ester-linked acetic acids. Also present are β-glucans made up of glycosyl chains linked at 1,3 and 1,4-β. In monocotyledons, cellulose, heteroxylans and β-glucans may be from 06/04/2018, p. 81/244
66/127 present in approximately equal amounts, each constituting approximately 15-25% of the dry cell wall material. In addition, different plants may comprise different amounts and different compositions of pectic substances. Sugar beet, for example, contains approximately 19% pectin and approximately 21% arabinane on a dry weight basis.
Consequently, a composition of the invention can be adjusted taking into account the specific raw material (also called substrate) that must be used. This means that the spectrum of activities in a composition of the invention can vary depending on the substrate in question.
Enzyme combinations or physical treatments can be administered concurrently or in sequence. Enzymes can be produced or exogenously in microorganisms, yeasts, fungi, bacteria or plants, being then isolated and added to the lignocellulosic substrate. Alternatively, the enzymes are produced, but not isolated, and the must of fermentation of crude cell mass, or vegetable material (such as corn stubble) and the like are added to the raw material. Alternatively, the crude cell mass or enzyme production medium or plant material can be treated to prevent further microbial growth (by heating or by adding antimicrobial agents, for example) and then being added to the raw material. These crude enzyme mixtures can include the enzyme-producing organism. Alternatively, the enzyme can be produced in a fermentation that uses raw material (as of 06/04/2018, page 82/244
67/127 as corn stubble) to provide nutrition to an organism that produces the enzyme (s). In this way, the plants that produce the enzymes can serve as the lignocellulosic substrate and be added to the lignocellulosic raw material. Carbohydrate polymers (cellulose and hemicellulose) are closely linked to lignin by hydrogen bonds and covalent bonds. Consequently, a polypeptide of the invention can be used in the treatment of lignocellulolytic material. In this document, lignocellulose material is a material that comprises or essentially consists of lignocellulose. Therefore, in a method of the invention for the treatment of a polysaccharide other than starch, the polysaccharide other than starch can be a lignocellulosic material / lignocellulosic biomass.
According to, the invention proposes a method of treating a substrate comprising non-starch polysaccharide in which the treatment comprises the degradation and / or hydrolysis and / or modification of the cellulosic substance and / or the hemicellulosic and / or pectic.
Endol, 4-p-glucanases (EG) and exocelobiohydrolases (CBH) catalyze the hydrolysis of cellulose insoluble in cellelo-glucose (cellobiosis as a main product) while β-glucosidases (BG) convert oligosaccharides, mainly cellobiosis and cellotriosis into glucose.
Xylanases together with other accessory enzymes, α-L-arabinofuranosidases, feruloyl and acetylxylan esterases, glucuronidases and β-xylosidases, catalyze the hydrolysis of hemicelluloses.
of 06/04/2018, p. 83/244
68/127
Pectinases, endo polygalacturonase, for example, a pectin methyl esterase, an endo-galactanase, a βgalactosidase, a pectin acetyl esterase, an endopectin lyase, a pectate lyase, a ramnogalacturonan hydrolase, a ramnogalactonone hydrochloride, a ramnogalacturonone , a ramnogalacturonane galacturonohydrolase, a xylogalacturonase, an arabinofuranosidase.
Degradation within this context indicates that the treatment results in the generation of hydrolysis products from a cellulosic and / or hemicellulosic substance and / or a pectic, that is, they are present as a result of treatment saccharides of lesser length than would be present in a polysaccharide non-starch without treatment. Thus, degradation within this context can result in the release of oligosaccharides and / or sugar monomers.
All plants contain polysaccharides other than starch like virtually all plant-derived polysaccharide materials. Consequently, in a method of the invention for the treatment of substrate comprising a non-starch polysaccharide, such substrate can be provided in the form of a plant or plant derived material or a material comprising a plant or plant derived material, pulp vegetable, for example, a plant extract, a food or ingredient for food, a fabric, a textile or a garment.
The lignocellulolytic biomass suitable for use in the invention includes biomass and may include virgin and / or non-virgin biomass such as agricultural biomass, commercial organic products, construction and demolition debris, from 06/04/2018, p. 84/244
69/127 municipal solid waste, used paper and garden waste. Common forms of biomass include trees, shrubs and grasses, wheat, wheat husks, sugarcane bagasse, corn, corn husks, corn cobs, corn grains, including fiber from grains, by-products and by-products from milling. grains such as corn, wheat and barley (including wet and dry milling) often referred to as fibers as well as municipal solid waste, used paper and garden waste. Biomass can also be, but without limitation, herbaceous material, agricultural waste, forest waste, municipal solid waste, used paper and pulp and pulp and paper manufacturing waste. Agricultural biomass includes branches, shrubs, reeds, corn and corn husks, energy crops, forests, fruits, flowers, grains, grasses, herbaceous crops, leaves, bark bark, needles, logs, roots, seedlings, short-rotation woody crops , shrubs, Panicum virgatum, trees, vegetables, fruit skins, vines, sugar beet pulp, wheat milling residues, oat skins and hard and soft woods (not including woods containing harmful materials). In addition, agricultural biomass includes organic waste materials generated by agricultural processes including agricultural and forestry activities, including specifically waste from forest material. Agricultural biomass can be any of the above mentioned individually or in any combination or mixture of them. Other examples of suitable biomass are orchard shavings, chaparral, mill waste, urban wood waste, municipal waste, wood waste, thinning of 06/04/2018, p. 85/244
70/127 forestry, short rotation wood crops, industrial residues, wheat straw, oat straw, rice straw, barley straw, rye straw, flax straw, soy husks, rice husks, straw rice, corn gluten ration, corn husks, sugar cane, corn stubble, corn stalks, corn cobs, corn husks, prairie grasses, Tripsacum dactyloides, tick (Alopecurus); sugar beet pulp, citrus pulp, seed husks, cellulosic animal waste, grass clippings waste, cotton, algae, trees, shrubs, grasses, wheat, wheat straw, cane bagasse, corn, corn husks, cobs maize, maize grain, grain fibers, products and secondary products from wet or dry grain milling, municipal solid waste, paper waste, garden waste, herbaceous material, agricultural waste, forest waste, municipal solid waste, waste paper, pulp, paper mill waste, branches, shrubs, reeds, corn, corn husks, an energy crop, forestry material, fruit, flowers, grains, grasses, herbaceous crops, leaves, bark of trees, needles, logs, roots, seedlings, shrubs, Tripsacum dactyloides, trees, vegetables, fruit peels, sugar beet pulp vines, wheat milling residues, husks oatmeal, wooden du soft or organic residues generated from an agricultural process, residues from forest wood, or a combination of any two or more of them.
In addition to virgin biomass or raw materials already processed in the food and feed or paper industries of 06/04/2018, p. 86/244
71/127 and pulp, the biomass / raw material can also be previously treated with heat, mechanical and / or chemical modification or any combination of such methods to increase enzymatic degradation.
Pre-treatment
Before the enzymatic treatment, the lignocellulosic material can be previously treated. The pretreatment can comprise the exposure of the lignocellulosic material to an acid, a base, an ionic liquid, a solvent, heat, a peroxide, ozone, mechanical grinding, grinding grinding or rapid depressurization or a combination of any two or more of them. This pre-chemical treatment is often combined with a pre-heat treatment, such as at 150 to 220 ° C for a period of 1 to 30 minutes.
After the pre-treatment step, a liquefaction / hydrolysis or saccharification step involving incubation with an enzyme or a mixture of enzymes can be used. Pretreatment can be conducted at many different temperatures. In one embodiment, the pre-treatment takes place at a temperature better suited to the enzyme mixtures being tested or at the optimum temperature of the predicted enzyme
of the enzymes to be tested. The temperature of the treatment previous can vary in about 10 ° C The about 95 ° C, in about 20 ° C The about 85 ° C, in about 30 ° C The about 70 ° C, in about 40 ° C The about 60 ° C, in about 37 ° C The about 50 ° C, preferably approximately
of 06/04/2018, p. 87/244
72/127
37 ° C to approximately 80 ° C, more preferably from approximately 60-70 ° C being even more preferable at approximately 65 ° C. The pH of the pretreatment mixture can vary from approximately 2.0 to approximately 10.0, but is preferred from approximately 3.0 to approximately 7.0, with more preferably approximately 4.0 to approximately 6.0, being even more preferable preferably from approximately 4.0 to approximately 5.0. Again, the pH can be adjusted to maximize enzyme activity and can be adjusted with the addition of the enzyme. Comparing the results of the test results of this test will allow the method to be modified to better fit the enzymes being tested.
The reaction of the liquefaction / hydrolysis step or the previous saccharification can occur from several minutes to several hours, such as from approximately 1 hour to approximately 120 hours, preferably from approximately 2 hours to approximately 48 hours, more preferably from approximately 2 to approximately 24 hours, more preferably from approximately 2 to approximately 6 hours. Cellulase treatment can take place for several minutes to several hours, such as from approximately 6 hours to approximately 120 hours, preferably from approximately 12 hours to approximately 72 hours, more preferably from approximately 24 to 48 hours.
Saccharification
The invention proposes a method for the production of a sugar from lignocellulosic material, this method comprising placing a polypeptide of the invention for 06/04/2018, p. 88/244
73/127 a composition of the invention in contact with the lignocellulosic material.
This method allows free sugars (monomers) and / or oligosaccharides to be generated from lignocellulosic biomass. These methods involve converting the lignocellulosic biomass to release sugars and small oligosaccharides with a polypeptide or composition of the invention.
The process of converting a complex carbohydrate such as lignocellulose to sugars preferably allows conversion to fermentable sugars. Such a process can be known as saccharification. Consequently, a method of the invention can result in the release of one or more hexose and / or pentose sugars, such as one or more of glucose, xylose, arabinose, galactose, galacturonic acid, glucuronic acid, mannose, rhamnose, ribose and fructose.
Accordingly, another aspect of the invention includes methods using the polypeptide of the composition of the invention, described above together with other enzymatic or physical treatments such as temperature and pH to convert the lignocellulosic plant biomass into sugars and oligosaccharides.
Although the composition has been discussed as an individual mixture, it is known that the enzymes can be added in sequence, and the temperature, pH and other conditions can be changed to increase the activity of each individual enzyme. Alternatively, an optimum pH and temperature can be determined for the enzyme mixture.
The enzymes are reacted with substrate under conditions of 06/04/2018, p. 89/244
74/127 appropriate. Enzymes can be incubated, for example, at approximately 25 ° C, approximately 30 ° C, approximately 35 ° C, approximately 37 ° C, approximately 40 ° C, approximately 45 ° C, approximately 50 ° C, approximately 55 ° C, approximately 60 ° C, approximately 65 ° C, approximately 70 ° C, approximately 75 ° C, approximately 80 ° C, approximately 85 ° C, approximately 90 ° C or more. That is, they can be incubated at a temperature ranging from approximately 20 ° C to approximately 95 ° C, for example, in buffers of low to medium ionic intensity and / or pH from low to neutral. Average ionic intensity means that the buffer has an ionic concentration of approximately 200 millimol (mM) or less for any ionic component. The pH can vary from approximately pH
2.5, approximately PH 3.0, approximately PH 3.5, about PH 4.0 , about PH 4.5, about PH 5, about PH 5.5, about PH 6, about PH 6.5, about PH 7, about PH 7.5, about PH 8.0, approximately PH 8.5.
Generally the pH limits will vary from approximately pH 3.0 to approximately pH 7. For ethanol production an acidic medium at pH = 4 can be used, for example, whereas for the production of biogas a neutral pH, such as as pH = 7. Incubation of enzyme combinations under these conditions results in the release of substantial amounts of lignocellulose sugar. Substantial amount means at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of available sugar.
Polypeptides, such as enzymes, may be from 6/4/2018, p. 90/244
75/127 produced both exogenously in microorganisms, yeasts, fungi, bacteria, or plants, being then isolated and added, for example, to the lignocellulosic material. Alternatively, enzymes are produced, but not isolated, and the wort from fermenting the crude cell mass, or plant material (such as corn stubble) and the like can be added to the raw material, for example. Alternatively, the crude cell mass or enzyme production medium or plant material can be treated to prevent further microbial growth (by heating or adding antimicrobial agents, for example), then being added, for example, to the raw material. These crude enzyme mixtures can include the organism that produces the enzyme. Alternatively, the enzyme can be produced in a fermentation that uses raw materials (such as corn stubble) to provide nutrition to an organism that produces an enzyme (s). In this way, the plants that produce the enzymes can themselves serve as a lignocellulosic raw material and be added to the lignocellulosic raw material.
Fermentation of sugars
Fermentable sugars can be converted into value-added fermentation products, including non-limiting examples of them amino acids, vitamins, pharmaceuticals, animal feed supplements, fine chemicals, chemical raw materials, plastics, solvents, fuels or other organic polymers , lactic acid and ethanol, including fuel ethanol. More specifically the sugars can be from 06/04/2018, p. 91/244
76/127 combination of lignocellulosic used as raw material for fermentation in chemicals, plastics, such as, for example, succinic acid and (bio) fuels, including ethanol, methanol, liquid fuels of synthetic butanol and biogas.
In the method of the invention, for example, an enzyme or enzymes acts on a substrate or vegetable biomass, serving as a substrate, in order to convert this complex substrate into simple sugars and oligosaccharides for the production of ethanol or other useful fermentation products.
Sugars released from biomass can be converted into useful fermentation products, such as one that includes, but is not limited to, amino acids, vitamins, pharmaceuticals, animal feed supplements, fine chemicals, chemical raw materials, plastics and ethanol, including fuel ethanol.
Consequently, the invention proposes a method for the preparation of a fermentation product, comprising the method:
The. the degradation of lignocellulose using a method as described in this document; and
B. fermentation of the resulting material to prepare a fermentation product.
Fermentation can be conducted under aerobic or anaerobic conditions. It is preferable that the process is conducted under micro-aerophilic conditions or under conditions of limited oxygen.
An anaerobic fermentation process is defined in this document as a fermentation process conducted in the absence of oxygen or one in which it is not from 06/04/2018, p. 92/244
77/127 substantially no oxygen is consumed, preferably approximately 5 or less approximately 2.5 or less or approximately 1 mmol / L / h or less and in which the organic molecules serve as both electron donors and electron acceptors.
A fermentation process with limited oxygen is a process in which oxygen consumption is limited by the transfer of oxygen from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the incoming gas flow as well as the actual properties of the mixture / mass transfer of the fermentation equipment used. It is preferable in a process under limited oxygen conditions that the rate of oxygen consumption is at least approximately 5.5, at least approximately 6, being even more preferable that it is at least approximately 7 mmol / L / h.
A method for preparing a fermentation product can optionally comprise recovering the fermentation product.
SSF
Fermentation and The saccharification can also be run on mode in Saccharification and Fermentation Concurrent (SSF) . An of advantages this way is the reduction inhibition of sugar about hydrolysis enzymatic
(inhibition of sugar on cellulases is described by Caminal B&B Vol. XXVII Pp 1282-1290).
Fermentation Products
Fermentation products that can be produced according to the invention include amino acids, vitamins, pharmaceuticals, animal feed supplements, from 06/04/2018, p. 93/244
78/127 fine chemicals, chemical raw materials, plastics, solvents, fuels or other organic polymers, lactic acid and ethanol, including fuel ethanol (the term ethanol meaning it includes ethyl alcohol or mixtures of ethyl alcohol and water).
Specific value-added products that can be produced by the methods of the present invention include, but are not limited to, biofuels (including ethanol and butanol and biogas); lactic acid; a plastic; a special chemical; an organic acid, including citric acid, succinic acid, fumaric acid, itaconic acid and maleic acid; 3-hydroxy-propionic acid; acrylic acid; Acetic Acid; 1,3-propane-diol; ethylene, glycerol; a solvent; a supplement for animal feed; a pharmaceutical product, such as a β-lactam antibiotic or cephalosporin; vitamins; an amino acid, such as lysine, methionine, tryptophan, threonine, and aspartic acid; an industrial enzyme, such as a protease, a cellulase, an amylase, a glycanase, a lactase, a lipase, a lyase, an oxide reductase, a transferase or a xylanase; and a chemical raw material.
Biogas
The invention also proposes the use of a polypeptide or composition as described herein in a method for preparing biogas. Biogas typically refers to a gas produced by the biological decomposition of organic matter, a material containing carbohydrates other than starch, in the absence of oxygen. Biogas originates from biogenic material and is a type of biofuel. A type of biogas is produced by the digestion of 06/04/2018, p. 94/244
79/127 or anaerobic fermentation of biodegradable materials, such as biomass, manure, silage or sewage, municipal waste and energy crops. This type of biogas consists mainly of methane and carbon dioxide. Methane gas can be combusted or oxidized with oxygen. The air contains 21% oxygen. This release of energy allows biogas to be used as a fuel. Biogas can be used as a low-cost fuel in any country for any heating purpose, such as cooking. It can also be used in modern waste management facilities where it can be used to operate any type of combustion engine, to generate either mechanical or electrical energy.
The first step in the production of microbial biogas consists of the enzymatic degradation of polymers and complex substrates (of carbohydrates other than starch, for example). Accordingly, the invention proposes a method for preparing biogas in which a substrate comprising non-starch carbohydrate is brought into contact with a polypeptide or composition of the invention, to produce fermentable material that can be converted into biogas by an organism such as a microorganism. In such a method, a polypeptide of the invention can be provided by means of an organism, a microorganism that expresses such a polypeptide, for example.
Use of enzymes in food products.
The polypeptides and compositions of the invention can be used in a method of processing plant material to degrade or modify the cellulose or hemicellulose constituents or pectic substance of the cell walls of 04/06/2018, p. 95/244
80/127 vegetable or fungal material. Such methods can be useful in the preparation of food products. Accordingly, the invention proposes a method for the preparation of a food product, such method comprising incorporating a polypeptide or composition of the invention during the preparation of the food product.
The invention also proposes a method of processing a plant material, such method comprising placing the plant material in contact with a polypeptide or composition of the invention to degrade or modify the cellulose in the (plant) material. It is preferable that the plant material is a vegetable pulp or plant extract, such as its juices.
The present invention also proposes a method for reducing the viscosity, transparency and / or filterability of a plant extract, such method comprising placing the plant extract in contact with a polypeptide or composition of the invention in an amount effective to degrade cellulose or hemicellulose or substances pectic substances contained in the plant extract.
Vegetable and cellulose / hemicellulose / pectic substance materials include vegetable pulp, plant parts and plant extracts. Within the context of the invention an extract from a plant material is any substance that can be derived from the plant material by extraction (mechanical and / or chemical), processing or other separation techniques. The extract can be juice, nectar, base or concentrates prepared from these. The plant material may comprise or be derived from vegetables, such as carrots, celery, onions, plants from 06/04/2018, p. 96/244
81/127 of pods or leguminous plants (soybeans, soybeans, peas) or fruits, such as pomes or walnuts (apples, pears, quince etc.), grapes, tomatoes, citruses (orange, lemon, tangerine lime), melons , plums, cherries, black currant, red currant, raspberries, strawberries, cranberry, pineapple and other tropical fruits, trees and parts of them (such as pine pollen, for example), or cereals (oats, barley, wheat, corn, rice). The material (to be hydrolyzed) can also consist of agricultural residues, such as sugar beet pulp, corn cobs, wheat straw, (shredded) nut shells or recyclable materials, such as (waste) paper, for example.
The polypeptides of the invention can therefore be used to treat plant material including plant pulp and plant extracts. They can also be used to treat liquid or solid foods and edible food ingredients or can be used in the extraction of coffee, vegetable oils, starch or as a thickener in food.
Typically the polypeptides of the invention are used as an enzyme composition / preparation as described above. The composition will generally be added to the vegetable pulp which can be obtained by mechanical processing, for example, such as crushing or grinding plant material. Incubation of the composition with the plant will typically be conducted for a period ranging from 10 minutes to 5 hours, such as 30 minutes to 2 hours, preferably for approximately 1 hour. The processing temperature preferably ranges from approximately 10 ° C to approximately 55 ° C, as well as approximately from 06/04/2018, p. 97/244
82/127
15 ° C to approximately 25 ° C, with an optimum of approximately 20 ° C, and from approximately 10 g to approximately 300 g, preferably from approximately 30 g to approximately 70 g, ideally approximately 50 g of enzyme per ton material to be treated.
All enzymes or their used compositions can be added in sequence or simultaneously to the vegetable pulp. Depending on the composition of the enzyme preparation, the plant material can first be mashed (such as reduced to a paste, for example) or liquefied. Using
polypeptides from invention can to be improved the parameters such as the yield gives far end, The extract viscosity and / or quality of extract. Alternatively, or in addition to the above, one
The polypeptide of the invention can be added to the raw juice obtained by pressing or liquefying the vegetable pulp. The treatment of raw juice will be carried out in a manner similar to that of vegetable pulp with respect to dosage temperature and duration. Again, other enzymes can be included, such as those discussed above. Typical incubation conditions are those described in the previous paragraph.
When the raw juice has been incubated with the polypeptides of the invention, the juice is then centrifuged or (ultra) filtered to produce the final product.
After treatment with the polypeptide of the invention the (final) product can be heat treated, such as at approximately 100 ° C, for example, for a period of approximately 1 minute to approximately 1 hour, under conditions such as to partially or completely inactivate the (s) of 06/04/2018, p. 98/244
83/127 polypeptide (s) of the invention.
A composition containing a polypeptide of the invention can also be used during the preparation of fruit or vegetable purees.
The polypeptide of the invention can also be used in beer, wine, distillation or bakery. It can therefore be used in the preparation of alcoholic beverages such as wine and beer. It can improve the filterability or transparency of beers, for example, must (containing barley malt and / or sorghum, for example) or wine.
In addition, a polypeptide or composition of the invention can be used for the treatment of used grains from brewers, that is, residues from the production of beer must containing malted barley or barley or other cereals, in order to improve the use of residues , such as for animal feed.
The polypeptide can assist in removing
organic substances dissolved in the broth or the middle of culture, us cases where waste from distilleries from source organic are converted biologically in biomass microbial The polypeptide of invention can will improve filterability and / or reduce the viscosity in syrups glucose such like the proceeding of cereals produced by liquefaction (with α-amylase, for example).
In the bakery industry, the polypeptide can improve the structure of the dough, modify its stickiness or flexibility, improve the volume of the bread and / or the structure of crumbs or confer better textural characteristics, from 06/04/2018, p. 99/244
84/127 such as the quality of breaking, crushing or crumb formation.
The present invention therefore relates to methods for the preparation of a dough or a cereal-based food product comprising incorporating into the dough a polypeptide or composition of the present invention. This can improve one or more properties of the dough or cereal-based food product obtained from the dough in relation to a bread dough or a cereal-based food product to which the polypeptide has not been incorporated.
The preparation of the cereal-based food product according to the invention may further comprise steps known in the art such as boiling, drying, frying, steaming or baking the obtained dough.
Products that are made from a dough that is boiled are, for example, pasta, boiled dumplings, products that are made from fried dough are, for example, donuts, fried dumplings, fried dough, products that are made from baked dough steamed dumplings are, for example, steamed dumplings and pasta, examples of products that are made of dry dough are dry pasta and noodles and examples of baked dough products are bread, cookies, cake.
The term improved property is defined in this document as any property of a dough and / or a product obtained from dough, especially a cereal-based food product that is improved by the action of the polypeptide according to the invention in relation to the dough or the product to which the polypeptide according to the invention of 06/04/2018, p. 100/244
85/127 has not been incorporated. The improved property may include, but is not limited to, greater dough resistance, greater dough elasticity, increased dough stability, a better ability to be handled by dough machines, improved dough proof resistance, reduced stickiness of the dough, an improved extensibility to dough, a greater volume of the cereal-based food product, less blistering of the cereal-based food product, an improved crumb structure of the baked product, an improved softness of the cereal-based food product cereal, an improved taste of the cereal-based food product, better mold resistance of the cereal-based food product. Improved properties in relation to the type of pasta and pasta of cereal products are, for example, greater firmness, less stickiness, improved cohesion and less losses due to cooking.
The improved property can be determined by comparing a cereal based dough and / or food product with or without the addition of a polypeptide of the present invention. Organoleptic qualities can be assessed using well established procedures in the bakery industry and may include, for example, the use of a panel of trained taste tasters.
The term dough as defined in this document consists of a mixture of cereal flour and other ingredients that is firm enough to be kneaded or extended. Examples of cereals are wheat, rye, maize, maize, barley, rice, granulated grains, buckwheat and oats. The term wheat, here and then, if from 06/04/2018, p. 101/244
86/127 is intended to cover all species of the genus Triticum, aestivum, durum and / or spelta, for example. Examples of other suitable ingredients are: the polypeptide according to the present invention, additional enzymes, chemical additives and / or processing aids. The dough can be fresh, frozen, pre-trimmed, or precooked. The preparation of a dough from the ingredients described above is well known in the art and comprises mixing the ingredients and process aids and one or more molding and optionally fermentation steps. The preparation of frozen dough is described by Kulp and Lorenz in Frozen and Refrigerated Doughts and Batters.
The term cereal-based food product is defined in this document as any product prepared from dough or of a soft or crunchy character. Examples of cereal-based food products, both white, light or dark in color, which can be advantageously produced by the present invention are bread (especially white, whole wheat or rye bread), typically in the form of bread or bread , loaf-type bread, pasta, macaroni, donuts, donuts, cake, flatbread, tortillas, tacos, cakes, pancakes, cookies, cookies, pie crust, steamed bread and crispy bread and the like.
The term baked product is defined in this document as any cereal-based food product prepared by baking the dough.
Non-starch polysaccharides (NSP) can increase the viscosity of the material being digested, which can, in turn, reduce the availability of nutrients and the performance of 06/04/2018, p. 102/244
87/127 of the animals. The use of the polypeptide of the present invention can improve the use of phosphorus as well as mineral cations and the polypeptide during the digestion of the animal.
Adding specific nutrients to the feed improves the animal's digestion and therefore reduces feed costs. A large number of feed additives are now being used and new programs are being continuously developed. The use of specific enzymes, such as enzymes that degrade non-starch carbohydrates, could break down the fiber releasing energy, also increasing the digestibility of the polypeptide due to the better accessibility of the polypeptide when the fiber is broken down. In this way, the costs with the feed could be reduced, and the levels of polypeptide in the feed could also be reduced.
Non-starch polysaccharides (NSPs) are also present in virtually all feed ingredients of plant origin. NSPs are poorly used and can, when solubilized, have adverse effects on digestion. Enzymes can contribute to a better use of these NSPs and consequently reduce any anti-nutritional effect. The enzymes that degrade the non-starch carbohydrates of the present invention can be used for this purpose in cereal-based diets for poultry and, to a lesser extent, for pigs and other species.
A polypeptide / enzyme that degrades non-starch carbohydrates of the present invention (of a composition comprising the polypeptide / enzyme of the invention) can be used in the detergent industry, for the removal of carbohydrate-based stain clothing, for example. One of 06/04/2018, p. 103/244
The detergent composition can comprise a polypeptide / enzyme of the invention and, in addition, one or more of a cellulase, a hemicellulase, a pectinase, a protease, a lipase, a cutinase, an amylase or a carboidase.
use of enzymes in detergent compositions
A detergent composition comprising a polypeptide or composition of the present invention can be in any convenient form, a paste, a gel, a powder or a liquid, for example. A liquid detergent can be aqueous, typically containing up to approximately 70% water and approximately 0 to approximately 30% organic solvent or a non-aqueous material.
Such a detergent composition can be formulated, for example, in the form of a detergent composition for washing clothes by hand or machine including an additive laundry composition suitable for the pre-treatment of stained fabrics and an added fabric softener rinse composition. fabric, or it can be formulated as a detergent composition for home use in hard surface cleaning operations, or it can be formulated for hand or machine dishwashing operations.
In general, the properties of the enzyme must be compatible with the selected detergent (optimal pH, compatibility with other enzymatic and / or non-enzymatic ingredients, for example, etc.) and the enzyme (s) must be present in an amount effective.
A detergent composition may comprise a surfactant, an anionic or non-ionic surfactant, an agent from 06/04/2018, p. 104/244
89/127 detergent loading or complexation, one or more polymers, a bleaching system (a source of H2O2, for example), or an enzyme stabilizer. A detergent composition may also comprise any other conventional detergent ingredient, such as, for example, a conditioner, including a clay, a foam intensifier, a foam suppressor, an anti-corrosion agent, a dirt-suspending agent, an anti-fouling agent. redeposition of dirt, a dye, a bactericide, an optical brightener, a hydrotrope, a grime inhibitor or a perfume.
Use of enzymes in the processing of paper and pulp A polypeptide or composition of the present invention can be used in the paper and pulp industry, among others 15 in the bleaching process to increase the brightness of bleached pulps, thus reducing the amount of chlorine used in bleaching stages, and to increase pulp freedom in the recycled paper process (Eriksson, KE L, Wood Science and Technology 24 (1990): 79-101; Paice, et al., Biotechnol. and Bioeng. 32 (1988 ): 235-239 and Pommier et al., Tappi Journal (1989): 187191). In addition, a polypeptide or composition of the invention can be used for the treatment of lignocellulosic pulp in order to improve its targeting ability. Thus, the amount of chlorine needed to obtain a satisfactory pulp bleaching can be reduced.
A polypeptide or composition of the invention can be used in a method of reducing the rate at which cellulose-containing fabrics become rough or to reduce the roughness of cellulose-containing fabrics,
Petition 870180047364, of 06/04/2018, p. 105/244
90/127 the method comprising treating cellulose-containing tissues with a polypeptide or composition as described above. The present invention further relates to a method for providing clarification of colored tissue containing cellulose, the method comprising treating colored tissue containing cellulose with a polypeptide or composition as described above, and a method of providing a localized variation in the color of colored fabrics containing cellulose, the method comprising treating colored fabrics containing cellulose with a polypeptide or composition as described above. The methods of the invention can be conducted by treating fabrics containing cellulose during washing. However, if desired the treatment of the fabrics can also be carried out during the dressing or rinsing or simply by adding the polypeptide or the composition as described above to the water in which the fabrics are immersed or will be immersed.
Other uses of the enzyme
In addition, the polypeptide or composition of the present invention can also be used in an antibacterial formulation as well as in pharmaceutical products such as throat lozenges, toothpastes and mouthwashes.
The examples below illustrate the invention:
EXAMPLES
General Materials and Methods
Strains
Strains of Talaromyces emersonii of the present invention are derived from ATCC16479 which was previously called 06/04/2018, p. 106/244
91/127
Penicillium geosmithia emersonii. Other ATCC 16479 designations of T. emersonii are CBS393.64, IFO31232 and IMI116815.
DNA procedures.
Standard DNA procedures were conducted as described in other documents (Sambrook et al., 1989,
Molecular cloning: a laboratory manual 2a. Ed., Cold Spring Harbor laboratory press, Cold Spring Harbor, New York) unless otherwise stated. The DNA was amplified using a verification enzyme Phusion polymerase (Finnzymes). The restriction enzymes came from Invitrogen or New England Biolabs
Means and solutions:
Potato dextrose agar, PDA (Fluka, Cat. No. 70139) Potato extract 4 g / L Dextrose 20 g / L Bacto agar 15 g / L PH 5.4 Water Adjust until one liters Sterilization 20 minutes at 120 ° C
Talaromyces agar medium
Fraction of salt in. 3 15g Cellulose (3%) 30 g Peptone Bact 7.5 g Grain Flour 15 g KH2PO4 5 g CaCl2.2aq 1 g Bacto agar 20 g PH 6, 0 Water Adjust up to one
Petition 870180047364, of 06/04/2018, p. 107/244
92/127
Sterilization 20 minutes at 120 ° C Composition of the salt fraction
The salt fraction was in accordance with the disclosure of WO98 / 37179, Table 1. Deviations from the composition of this table
were CaCl2.2aq 1.0 g / L, KC1 1.8 g / L, citric acid laq 0.45 5 g / L (chelating agent) Means in shake flasks Talaromyces medium 1 Glucose 20 g / L Yeast extract (Difco) 20 g / L Clerol FBA3107 (AF) 4 drops / L PH 6, 0 Sterilization 20 minutes at 120 ° C Talaromyces medium 2 Salt fraction 15 g Cellulose 30 g Peptone Bact 7.5 g Grain Flour 15 g KH2PO4 10 g CaCl ₂ .2H ₂ O 0.5 g Clerol FBA3107 (AF) 0.4 mL PH 5 Water Adjust up to one liter Sterilization 20 minutes at 120 ° C Talaromyces medium 3 Salt fraction 15 g Glucose 50 g Peptone Bact 7.5 g KH2PO4 10 g CaCl ₂ .2H ₂ O 0.5 g
Petition 870180047364, of 06/04/2018, p. 108/244
93/127
Clerol FBA3107 (AF)
PH
Water
Sterilization
Adjust up to one liter minutes at 120 ° C
Preparation of the spore batch
The strains were grown from raw material on Talaromyces agar in 10 cm diameter Petri dishes for 5-7 days at 40 ° C. Strain material was stored at -80 ° C in 10% glycerol.
Shake flask culture protocol
The spores were directly inoculated into 500 ml shake flasks containing 100 ml or Talaromyces medium 1 or 2 and incubated at 45 ° C at 2150 rpm in an incubator shaker for 3-4 days.
Sample preparation
For cultures in shake flasks, 3 ml of culture broth were transferred to a 12 ml disposable tube and centrifuged for 10 minutes at 5300 rotations. At least 1 mL of supernatant was collected.
Protein analysis
The protein samples were separated under reduction conditions in NuPAGE 4-12% Bis-Tris gel (Invitrogen, Breda, Netherlands) and stained as indicated. The gels were tinted either with InstantBlue (Expedeon, Cambridge, UK), or SimplyBlue safestain (Invitrogen, Breda, Netherlands) or SyproRuby (Invitrogen, Breda, Netherlands) according to the manufacturer's instructions.
For Western blot analysis, proteins were transferred to nitrocellulose. The nitrocellulose filter was blocked with TBST (Tris buffered saline from 06/04/2018, page 109/244
94/127 containing 0.1% Tween 40) containing 3% skimmed milk and was incubated for 16 hours with anti-FLAG M2 antibody (Sigma, Zwijndrecht, Netherlands). The spots were washed twice with TBST for 10 minutes and stained with horseradish peroxidase conjugated to rabbit anti-murine antibody (DAKO, Glostrup, Denmark) for 1 hour. After washing the spots five times with TBST for 10 minutes, the proteins were visualized using SuperSignal (Pierce, Rockford, U.S.A).
Cellulase Assays
1. Wheat straw test (WSU test)
Preparation of previously treated washed wheat straw substrate
The washed wheat straw substrate was homogenized using an ultra-turrax shaker, washed, lyophilized and ground before analysis.
Measurement of cellulase activity in WSU / mL
Cellulase activity was measured according to the invention in terms of Wheat Straw Units (WSU) per milliliter in a Wheat Straw test (WSU test). The washed wheat straw substrate was shaken in ultra-turrax, washed, lyophilized and crushed before analysis.
400 pL of supernatants collected from experiments in shaken flasks were diluted 16 times. Samples of 200 pL in duplicate were transferred to two suitable vials: a vial containing 700 pL at 3% (weight / weight) of dry material from the previously treated washed wheat straw substrate and 100 pL of buffered 250 mM citrate buffer at pH 4.5. The other bottle consisted of one from 06/04/2018, p. 110/244
95/127 control, in which 700 mol of dry material at 3% (weight / weight) of previously treated washed wheat straw substrate, were replaced by 700 pL of water, with 100 pL of 250 mM citrate buffer, buffered at pH 4.5. The test samples are incubated for 20 and / or 60 hours at 65 ° C. After incubation of the test samples, a fixed volume of D2O containing an internal standard, maleic acid, is added. The amount of sugar released is based on the signal between 5.25-5.20 ppm, in relation to the dimethylsilypentane sulfonate, determined by means of 1H NMR ^ -H operating at a proton frequency of 500 MHz, using a pulses with water suppression, at a temperature of 27 ° C. The cellulase enzyme solution may contain residual sugars. Therefore, the test results are corrected for the sugar content of the enzyme solution.
2. Endoglucanase activity (WBCU)
Endoglucanase catalyzes the hydrolysis of carboxymethyl cellulose. The amount of reducing sugars formed during the enzymatic reaction was determined with a dinitro-salicylic acid reagent. The samples were incubated in the presence of 18 g / L of carboxymethyl cellulose solution (Novacel, ref. 394) in acetate buffer pH 4.60 at 37 ° C. The incubation was stopped after 60 minutes by adding a sodium hydroxide solution. The samples were boiled for 5 minutes in the presence of a dinitro-salicylic acid reagent (Acros 15644500). After diluting with water, the color intensity was measured at 540 nm. The methodology was used as a relative method. The results were related to cellulase composition with an officially assigned activity. The activity was 06/06/2018, p. 111/244
96/127 expressed in WBCU units. The WBCU unit is defined as the amount of cellulase that hydrolyzes in one hour a number of glycosidic bonds equivalent to the production of 0.5 mg of glucose under the conditions of the assay. The activity was calculated using standard calculation protocols known in the art, using the DO540 delta graph by the activity of samples with a known activity, then calculating the activity of unknown samples using the equation generated from calibration line.
EXAMPLE 1
TRANSFORMATION OF Talaromyces emersonii WITH PLASMIDS CONTAINING FLLEOMYCIN RESISTANCE MARKERS.
This sample describes a method for transforming T. emersonii with the plasmid pAN8-l carrying a phleomycin resistance marker (Mattern, IE, Punt, PJ, Van den Hondel, CAMJJ, 1988. The Aspergillus transformation conferring phleomycin resistance vector. Fungai Genet .. Newsl. 35, 25).
Transformation of T. emersonii with pAN8-l
The spores were cultured for 16 hours at 45 ° C on a rotary shaker at 250 rpm in YGG medium (per liter: 8 g KC1, 16 g glucose.H2O, 20 ml of 10% yeast extract, 10 ml of 100 x pen / strep, 6.66 g YNB + amino acids, 1.5 g citric acid and 6 g K2HPO4). The mycelium was collected using a Miracloth filter (Calbiochem, Nottingham, United Kingdom). For the formation of protoplasts, per 2 g of mycelium 10 ml of STC buffer (per liter: 218 g of Sorbitol (1.2M), 7.35 g of CaCl2.2H2O, 10 mM of Tris / HCl pH 7.5) and 1 mL of the solution of 06/04/2018, p. 112/244 §Ί / ΥλΊ of glucanex (250 mg / mL mg / mL of Glucanex 200G (Novozymes, Bagsvaerd, Denmark) in H2O). The mixture was incubated on a rotary shaker at 100 rpm at 34 ° C for 90-150 minutes. The protoplasts were separated from the mycelium using a Miracloth filter and STC was added to a final volume of 45 mL. The protoplast suspension was centrifuged for 5 minutes at 1560 rotations at 4 ° C and was resuspended in STC buffer at a concentration of 08 protoplasts / mL. For the transformation, 200 pL of protoplast suspension were added to 10 pg of pAN8-1 DNA and TE buffer (10 mM Tris-HCl pH 7.5, 0.1 mM EDTA) and 8 pL of 0% aurintricarboxylic acid, 4 M. Subsequently, 100 pL of a PEG solution (20% PEG 4000 (Merck, Nottingham, UK) in STC) was added, and after incubating the DNA-protoplast suspension for 10 minutes at room temperature, he added up slowly
1.5 mL of PEG solution (PEG 4000 60% (Merck) in STC), with repeated mixing of the tubes. After an incubation for 15 minutes at 25 ° C, the suspensions were diluted with 2 ml of STC and mixed by inversion. Approximately 200 to 600 pL of protoplast suspension was added to 5 ml of soft agar (the regeneration medium containing 6 g / L of agar, without selection) and placed directly on plates in
plates petri 10 cm with 20 mL in middle in Regeneration 25 containing 10 pg / mL in phleomycin. 0 middle in Regeneration contains per liter: 6 g of NaN0 ₃ , 0, 52 g of KC1 , 1.52 g of
KH2PO4, 1.12 ml of 4 M KOH, 0.52 g of MgS0 ₄ .7H ₂ O, 22 mg of ZnS0 ₄ .7H2O, 11 mg of H3BO3, 5 mg of FeS0 ₄ .7H2O, 1.7 mg of C0CI2.6H2O, 1.6 mg of CuS0 ₄ .5H2O, 5 mg of MnCl2.4H2O, 1.5 mg of Na2Mo0 ₄ .2H2O, 50 mg of EDTA, 10 ml of 100 x pen / strep
Petition 870180047364, of 06/04/2018, p. 113/244
98/127 (Gibco), 2.5 g of glucose, 2.5 g of yeast extract, 341 g of sucrose, and 20 g of agar (overlapping 6 g / L).
After incubation for 4-6 days at 40 ° C, the conidiospores of the transformants were transferred to plates consisting of PDA supplemented with 10 pg / ml of phleomycin and incubated for 2 days at 40 ° C.
PCR analysis of transformants in fungal mycelium
The transformants were incubated on agar plates containing potato dextrose for two days at 40 ° C. Approximately one third of a colony was incubated for 1 hour in 25 pL of KC buffer (60 g / L of KC1, 2 g / L of citric acid, pH 6.2), supplemented with 5 mg / ml of Glucanex 200G ( Novozymes, Bagsvaerd, Denmark). Subsequently, 75 µl of DNA dilution buffer (10 mM Tris-HCl, 1 mM EDTA, 10 mM NaCl, pH 7.5) was added. The samples were incubated for 5 minutes at 98 ° C and subsequently diluted with 100 µL of H2O. A 5 µl aliquot of the mixture was used as a template for PCR.
The primers were synthesized by Invitrogen (Breda, Netherlands). The following PCR primers were used to amplify a 278 nucleotide pAN8-β-lactamase gene fragment:
Amp-For (SEQ ID NO: 1): TATGCAGTGCTGCCATAACCAT; and
Amp-Rev (SEQ ID NO: 2): GCAGAAGTGGTCCTGCAACTTT
The PCR conditions for the reactions: 50 µl of reaction mixture with 5 µl of template DNA, 20 pmol of each primer, 0.2 mM of dNTPs, 1 x buffer of 1 x Phusion HF and 1U of Phusion DNA polymerase , according to the Phusion High-Fidelity DNA Polymerase Manual (Finnzymes, Espoo, 06/06/2018, page 114/244
99/127
Finland), 30 s of denaturation at 98 ° C, amplification in 30
cycles (10 s at 98 ° C, 10 s a 60 ° C, 15 s at 72 ° C), is final incubation 10 minutes to 72 ° C. The results of the gel in agarose gel They are presented in Figure 1. One banner specific in PCR of
278 nucleotides were observed in transformants, but not in the empty strain, indicating that the transformants contained the ampicillin gene of the vector pAN8-. Thus, T. emersonii is successfully transformed with the vector pAN8-l.
To determine whether pAN8-1 is integrated into the genome, a Southern blot was performed. Chromosomal DNA was isolated from the transformants using the Puregene Yeast and Bacteria Kit (Gentra Systems Inc., Mineapolis, USA). The transformants were cultured for 16 hours in 10 ml of YGG medium at 45 ° C and the mycelium was used for the isolation of chromosomal DNA. Lysis of the mycelium (~ 50 mg fresh weight) was performed by adding 250 pL of Cell Suspension Buffer buffer (Puregene kit, Gentra Systems, Mineapolis, USA) and 50 pL of Glucanex 200G (Novozymes, Bagsvaerd, Denmark, 100 mg / mL in KCl-citrate buffer pH 6.2). The resuspended mycelium was incubated at 37 ° C for 1 hour. Subsequently, a centrifugation step was performed (1 minute at 15,700 rotations) and the pellet formed was resuspended in 600 pL of Cell Lysis Solution and 3 pL of Proteinase K solution (20 mg / ml, Invitrogen, Breda, Countries) (Low), then incubating at 55 ° C for 1 hour. Subsequent steps that included RNAse Treatment, Protein Precipitation, DNA Precipitation and DNA Hydration were conducted according to the supplier's protocol for 06/04/2018, p. 115/244
100/127 Gram positive bacteria.
Chromosomal DNA was digested with MluI and subjected to electrophoresis on a 0.7% (w / v) agarose gel agarose gel. DNA was transferred to Hybond N + (GE Healthcare, Eindhoven, Netherlands) by vacuum blotting. The blots were subsequently previously hybridized for approximately 1 hour at 42 ° C in ECL Gold hybridization buffer (GE Healthcare, Eindhoven, Netherlands) and hybridized overnight at 42 ° C with a labeled probe representing the resistance gene the ampicillin present in pAN8-l. The probe was obtained by PCR using the Amp-For primer (SEQ ID NO: 1) and the Amp-Rev (SEQ ID NO: 2) and pAN8-l as a template. The PCR conditions for the reaction: 30 s of denaturation at 98 ° C, amplification in 30 cycles (10 s to 98 ° C, 10 s to 60 ° C, 20 s to 72 ° C), and a final incubation of 5 minutes at 7 2 ° C. The probe was labeled according to the ECL method (GE Healthcare, Eindhoven, Netherlands). After hybridization, the blots were washed and treated with detection reagent according to the ECL method (GE Healthcare, Eindhoven, Netherlands). The signal was detected using the Biorad ChemiDoc XRS device according to the supplier's instructions.
The result of the Southern blot is shown in Figure 2. In lanes 2 and 3, two concentrations of the plasmid pAN8-1 were loaded onto the gel, which were detected as 6.1 kbp bands in the Southern blot. The 6.1 kbp band was not observed in T. emersonii transformers in pAN8-l (lanes 4 and 5), but instead the β-lactamase probe hybridized with chromosomal DNA fragments of different lengths, indicating that the plasmid is integrated with that of 06/04/2018, p. 116/244
101/127 genome.
The stability of the transformed phenotype was verified by purifying the pAN8-l transformants on plates containing potato agar and dextrose without selection of phleomycin. Individual colonies were subsequently purified on plates containing gown dextrose agar with phleomycin selection. Of the 20 transformants tested, all appeared to be resistant to phleomycin. Therefore, the pAN8-l vector is stably integrated into the T. emersonii genome.
This experiment clearly demonstrated that T. emersonii can be transformed with a plasmid, which is stably integrated into the T. emersonii genome.
EXAMPLE 2
TRANSFORMATION OF Talaromyces emersonii WITH PLASMIDS THAT CODE THE CELLULASES OF Talaromyces emersonii
This example describes the cloning and expression of T. emersonii β-glucanase CEB protein identified with FLAG in T. emersonii.
Cloning of the expression plasmid of I. emersonii pGBFINEBA7 encoding the CEB protein of I β-glucanase
emersonii identified with FLAG.
The gene encoding the T. emersonii β-glucanase CEB protein and a C-terminal FLAG identifier was synthesized by DNA2.0 (Menlo Park, USA) and cloned as a Pacl / Ascl fragment in pGBFIN-5, this plasmid being described in WO 9932617. The pGBFIN5 expression vector comprises the glycoamylase promoter, the cloning site, the terminator region, an amdS marker operably linked to the gpd promoter, and 3 'and 3' flanks of 06/04/2018, pg. 117/244
102/127 glaA. The amino acid and nucleotide sequences of the T. emersonii β-glucanase CEB protein identified with FLAG are represented respectively by SEQ ID NO: 3 and SEQ ID NO: 4. Figure 3 represents a pGBFINEBA7 map containing β CEB protein. -glucanase of T. emersonii under the control of the glycoamylase promoter within the vector pGBFIN-5.
Transformation of T. emersonii with pGBFINEBA7 Transformation of T. emersonii was carried out according to the protocol described in Example 1, except that T. emersonii was co-transformed with 2 pg of pAN8-1 and 10 pg of pGBFINEBA7 DNA. Co-transformants were identified by PCR analysis. The presence of plasmid pAN8-l was determined using the Amp-For primer (SEQ ID NO: 1) and
Amp-Rev (SEQ ID NO: 2). The primers below were used to amplify the T. emersonii βglucanase CEB coding sequence:
EBA7-For (SEQ ID NO: 5):
CAGCTTAATTAACACCGTCAAAATGGACCGTATAC; and
EBA7-Rev (SEQ ID NO: 6):
GGCGCGCCTTTACTTGTCATCATCATCCTTGTAGTCTGACTGGAAGGTGCTGCCAATG.
PCR conditions were used as described in Example 1.
Fermentations of T. emersonii in shake flasks
Transformants were cultured in shake flasks using Talaromyces medium 1 and Talaromyces medium 2, and samples were taken after 72 hours. The proteins in 65 pL of supernatant were precipitated by adding 228 pL of TCA-acetone (1.2 g of trichloric acid, 9 ml of acetone, 1 ml of H2O.
Petition 870180047364, of 06/04/2018, p. 118/244
103/127 of precipitation for 2 hours at -20 ° C, the samples were centrifuged at 14,000 rpm at 4 ° C for 10 minutes in an eppendorf centrifuge and the granules were washed with acetone. The dried granules were dissolved in 1 x sample buffer (25 µl of LDS sample buffer (Invitrogen, Breda, Netherlands), 10 µl of reducing agent (Invitrogen, Breda, Netherlands), 65 µl of H2O).
Protein Analysis
The protein samples were separated under reducing conditions in NuPAGE 4-12% Bis-Tris gel (Invitrogen, Breda, Netherlands). The gels were incubated with InstantBlue (Expedeon, Cambridge, UK) according to the manufacturer's instructions or used for Western blotting using a FLAG specific antibody.
The InstantBlue simulation results of the protein gel and Western blotting are shown in Figures 4A and 4B, respectively. The gel stained with InstantBlue showed a specific EBA7-FLAG band having approximately 58 kDa in supernatant from pGBFINEBA7 transformants grown in Talaromyces medium 1 (lanes 1 and 2). The EBA7-FLAG band cannot be observed in supernatants from transformants cultured in medium 2 of
Talaromyces due to the high protein content of proteins that are induced in cellulose (lanes 5 and 6). However, in Western blot we could observe a specific band of EBA7-FLAG protein in the supernatant of pGBFINEBA7 transformants cultured in each medium, indicating that the EBA7-FLAG protein is produced in glucose and cellulose-based media. As we were unable to detect any FLAG signal on the Western blot on 06/04/2018, p. 119/244
104/127
supernatants gives strain empty (lanes 6 and 7, 13 and 14 in Figure 4B), The protein express is protein recombinant. Determination of number of copies pGBFINEBA7's in
T transformers, emersonii
Two transformants were tested for EBA7-FLAG expression, transformant 1 # 6 and 1 # 14, and more product was observed in transformant 1 # 6 (compare lane 1 with lane 2 in Figure 4A; compare lane 2 + 3 and track 4 + 5 on
Figure 4B). To test whether the difference in expression level is due to differences in copy number, the chromosomal DNA was isolated and used for a PCR reaction. O
Chromosomal DNA was isolated from the cultured mycelium for 24 hours at 45 ° C on a rotary shaker at 250 rpm in YGG medium using the FastDNA Spin Kit (MP Biomedicals, Solon USA) according to the supplier's manual. Approximately 100 ng of DNA was used as a template for PCR. Part of the expression cassette was amplified using the EBA7-For primer (SEQ ID NO: 5) and the EBA7-Rev primer (SEQ ID NO:
6). Actin primers were used as a control for the amount of DNA that was used for PCR reactions. The following primers were used to amplify part of the T. emersonii 'actin gene.
Actina-For (SEQ ID NO: 8): CCACCTTCAACTCCATCATGAAG; and
Actin-Rev (SEQ ID NO: 9): TTAGAAGCACTTGCGGTGGA. The PCR mix was the same as described in EXAMPLE 1 and the following PCR conditions were used: 30 s of denaturation at 98 ° C, amplification in 20 cycles (10 s at 98 ° C, 15 s at
60 ° C, 30 s to 72 ° C), and a final 5 minute incubation at
72 ° C.
Petition 870180047364, of 06/04/2018, p. 120/244
105/127
As shown in Figure 4C, transformant 1 # 6 (lane 1) showed a stronger expression cassette PCR signal compared to transformant 1 # 14 (lane 2) which is in agreement with the difference in expression level. The result indicates that transformant 1 # 6 contains multiple copies of pGBFINEBA7.
Therefore, a recombinant protein was successfully expressed in T. emersonii. In addition, it is possible to generate transformants with multiple copies of the gene of interest.
EXAMPLE 3
MEASUREMENT OF CELLULASE ACTIVITY OF SUPERARS ISOLATED FROM Talaromyces emersonii TRANSFORMED WITH pGBFINEBA7
This example describes the measurement of endoglucanase activity in supernatants of T. emersonii transformed with pGBFINEBA7 (see EXAMPLE 2 for the description of the transformant). Activity was measured using carboxymethyl cellulose as a substrate and detecting reducing sugars using ® dinitrosalicylic acid.
T. emersonii transformants containing pGBFINEBA7 (see EXAMPLE 2) were used to inoculate 100 ml of media medium 1 incubated at 45 ° C at 250 rpm in an incubator shaker for 3 days. Supernatants were collected and used to measure endoglucanase activity. The results of the tests in the endoglucanase activity assay are shown in Table 1.
Table 1. Result of measurement of endoglucanase activity in supernatants of a vasa strain and a T. emersonii transformant.
Strain
Endoglucanase activity
Petition 870180047364, of 06/04/2018, p. 121/244
106/127
(WBCU / mL) pGBFINEBA7 1 # 6 321 Empty strain <1-
T. emersonii transformants expressing T. emersonii recombinant endoglucanase showed at least 32 times more endoglucanase activity compared to the wild type strain.
This experiment clearly demonstrated that the T. emersonii recombinant endoglucanase expressed in T. emersonii is active. Therefore, enzymes can be expressed in T. emersonii.
EXAMPLE 4
COMPARISON BETWEEN EXPRESSION ACTIVATED BY THE PROMOTER
OF GLYCOAMYLASE AND THE 3-PHOSPHATE PROMOTOR OF GLYCERIC ALDEHYDE DEHYDROGENASE IN Talaromyces emersonii
This example describes the cloning and expression of CEB protein from T. emersonii beta-glucanase identified with FLAG in T. emersonii under the control of the glyclic aldehyde phosphate dehydrogenase (gpd) promoter. The expression is compared to the expression of pGBFINEBA7.
Cloning of T. emersonii pGBFI N-Pgpd-EBA7 expression plasmid encoding the T. emersonii beta20 glucanase CEB protein identified with FLAG activated by the gpd promoter
The gene that consisted of the gpd promoter and the coding region of the T. emersonii beta-glucanase CEB protein and a C-terminal FLAG identifier was synthesized by DNA2.0 (Menlo Park, USA) and cloned via a link 3 points as Xhol / HindIII, HindIII / Ascí fragments in pGBFIN38, the plasmid being described in
Petition 870180047364, of 06/04/2018, p. 122/244
107/127
W02008053018. The pGBFIN38 expression vector comprises the gpd promoter, the cloning site, the terminator region, an amdS marker operably linked to the gpd promoter, and 3 'and 3 glaA flanks. The nucleotide sequences of the gpd promoter and the Kozak sequence are represented by SEQ ID NO: 7. The amino acid and nucleotide sequences of the T. emersonii beta-glucanase CEB protein are represented by SEQ ID NO: 3 and SEQ ID NO: 4, respectively. Figure 5 represents a pGBFIN-Pgpd-EBA7 map containing the T. emersonii beta-glucanase CEB protein under the control of the gpd promoter within the pGBFIN-38 vector.
Transformation of T. emersonii with pGBFIN-Pgpd-EBA7 Transformation of T. emersonii with pGBFIN-Pgpd-EBA7 was carried out as described in EXAMPLE 2.
Fermentations of T. emersonii in shake flasks
T. emersonii transformants containing either pGBFINEBA7 (transformant 1 # 6, see EXAMPLE 2) or pGBFIN-Pgpd-EBA7 were used for shake bottle fermentations. Shake flask fermentations and analysis of protein expression by Western blot analysis using a FLAG specific antibody were conducted as described in EXAMPLE 2.
The results of the Western blot are shown in Figure 6. Several dilutions of the supernatants were separated on gel to compare the expression between transformants. Supernatants (1: 100 dilution) from 3-day transformant 1 # 6 cultures in which EBA7 is triggered by the glaA promoter showed a strong (overexposed) EBA7FLAG band (lanes 9 and 15). The supernatant of 06/04/2018, p. 123/244
108/127 band had a supernatant from the per revealed that 3 days undiluted from three transformants in which EBA7 is triggered by the gpd promoter (lanes 5, 8 and 14) presented a band in the Western blot, but the intensity was lower compared to the transformant 1 # 6 diluted 100 times. No EBA7-FLAG expression was observed in the supernatants of an empty strain (lanes 1, 10 and 11). The estimate of the number of copies per transformant 8 # 18 contains the lowest number of copies whereas transformants 8 # 32 10 contains the highest number of copies (Figure 4C, lanes 46), which is correlated with the expression of EBA7- FLAG seen on Western blot (Figure 6, compare lanes 4, 7 and 13). As the copy number of pGBFINEBA7 transformant 1 # 6 is comparable to that of pGBFIN-Pgpd-EBA7 transformant 8 # 14 15 (compare lane 1 with lane 4 in Figure 4C), while the expression of EBA7-FLAG in the supernatants of transformant 1 # 6 is much higher compared to expression in transformant 8 # 14, the glaA promoter is stronger than the gpd promoter.
Endoglucanase activity assay (WBCU)
Samples from the experiment with shake flasks were also analyzed for endoglucanase activity. The same method was conducted as described in EXAMPLE 3.
The results of the tests in the endoglucanase activity assay are shown in Table 2.
Table 2. Results of measurement of endoglucanase activity in supernatants from an empty strain and from T. emersonii transformers
Strain Activity(WBCU / mL) in endoglucanase
Petition 870180047364, of 06/04/2018, p. 124/244
109/127
pGBFINEBA7 1 # 6 321 pGBFIN-Pgpd-EBA7 8 # 14 <10 pGBFIN-Pgpd-EBA7 8 # 18 <10 pGBFIN-Pgpd-EBA7 8 # 32 <10 Empty strain <10
Endoglucanase activity in supernatants from pGBFIN-Pgpd-EBA7 transformants was not increased above the bottom of the assay (<10 WBCU / mL), whereas endoglucanase activity in supernatants from pGBFINEBA7 1 # 6 transformants was at least 32 times higher compared to the wild type strain (321 WBCU / mL).
EXAMPLE 5
OVEREXPRESSION OF MULTIPLE CELLULASES OF Talaromyces emersonii IN Talaromyces emersonii
This example describes the cloning and expression of T. emersonii cellobiohydrolases-I (CBHI), T. emersonii cellobiohydrolase-II (CBHII), T. emersonii beta-glucanase (EG) and β-glucosidase (BG) from T. emersonii to T. emersonii. In addition, the cellulase activity of transformants is compared with the cellulase activity of an empty strain after the strains on glucose have been grown.
Cloning of T. emersonii genes into expression vectors
The genes encoding T. cobiohydrolases-I (CBHI)
emersonii, beta-glucanase (EG) CEA from T. emersonii, and βglycosidase (BG) from T. emersonii were synthesized by DNA2.0 (Menlo Park, USA) and cloned as an EcoRI / SnaBI fragment in the pGBTOPl2 vector, comprising the glycoamylase promoter and terminator sequence, resulting in the vector
Petition 870180047364, of 06/04/2018, p. 125/244
110/127 pGBTOPEBA205, pGBTOPEBA8 and pGBTOPEBA4, respectively. For cloning purposes, 198 nucleotides from part 3 'of the glycoamylase promoter were also synthesized along with the genes. The amino acid sequences of T. emersonii cellobiohydrolase-1 (CBHI), T. emersonii beta-glucanase (EG), and T. emersonii β-glycosidase (BG) are represented by SEQ ID NO: 10, 12, and 14, respectively. The DNA sequences of the genes are represented by SEQ ID NO: 11, 13 and 15, respectively. Figure 7 represents a map of a pGBTOPEBA205 containing the CBHI protein of T. emersonii under the control of the glaA promoter promoter within the pGBTOPl2 vector. pGBTOPEBA205 is representative of pGBTOPEBA8, which comprises EG of T. emersonii, and pGBTOPEBA4, which comprises BG of T.
emersonii.
The gene that encodes T. emersonii cellobiohydrolase-II (CBHII), was obtained from a T. emersonii cDNA library described in WO / 2001/070998. Figure 8 represents a pGBFINEBAl76 map containing the CBHII protein from T. emersonii under the control of the glaA promoter within the pGBFIN11 vector. The amino acid sequence and the nucleotide sequence are represented by SEQ ID NO: 16 and 17, respectively.
Transformation of T. emersonii with constructs that encode cellulases
T. emersonii transforms with constructs that encode cellulases were conducted as described in
EXAMPLE 1. In total, 10 pg of DNA were used to co-transform T. emersonii: 1 pg of pAN8-l and 2 pg of each of the vectors pGBTOPEBA4, pGBTOPEBA8, pGBTOPEBA205 and from 06/04/2018, pg. 126/244
111/127 pGBFINEBAl76.
Tests to obtain transformants that express all 4 cellulases
Transformants were removed from the plates and further cultured in 96-well microtiter plates (MTPs) containing Talaromyces medium in agar for 5 days at 40 ° C. The plates were replicated using a 96-pin replicator in 96-well MTPs containing PDA medium. The MTP plates were incubated for 3 days at 40 ° C and used to collect spores for shaking flask analysis. To this end, 100 µl of Talaromyces medium 1 was added to each well and after resuspending the mixture, 30 µl of spore suspension was used to inoculate 170 µl of Talaromyces medium 1 on MTP plates. The 96-well plates were incubated on humidity shakers (Infors) at 44 ° C at 550 rpm, and 80% humidity for 96 hours. Immersion plates were used to push the mycelium down, and subsequently approximately 100 pL of supernatant was collected per well.
Approximately 10 pL of supernatant was analyzed for protein expression using the E-PAGE 96 protein electrophoresis system (Invitrogen, Breda, Netherlands). The gels were stained with SimplyBlue protein and transformants expressing multiple cellulases were selected. Spores from interesting transformants were collected from the MTP master plates and used to prepare spore batches.
Fermentations of T. emersonii in shake flasks and sample analysis from 06/04/2018, p. 127/244
112/127
T. emersonii transformants expressing one or more cellulases were used for fermentation in shake flasks in Talaromyces medium 2 containing 5% glucose. Protein expression analysis by SDS-PAGE analysis was conducted as described in EXAMPLE 2. The proteins were visualized using protein staining with SYPRO Ruby.
The results of the SDS-PAGE on gel stained with SYPRO Ruby are shown in Figure 9A. The different transformants expressed different combinations and expression levels of cellulases. The supernatant from transformant 20 (strain 20) contained all 4 cellulases, whereas, on the other hand, no cellulase protein was observed in the empty strain (FBG142). However, a multiplicity of cellulases could be simultaneously overexpressed in T. emersonii in the presence of glucose.
To test cellulase activity in T. emersonii transformants expressing one or more cellulases, WSU activity was measured in supernatants of an empty strain and transformants. The results of the WSU test are shown in Figure 9B. In the supernatants collected after 72 hours of cultures of the empty strain grown in a medium containing glucose, no WSU activity can be measured. On the other hand, in the transformants a range of activities can be observed.
Transformant 20, which expressed all 4 cellulases, showed maximum activity: almost 6 WSU / mL, or 5 WSU / mL or more. Transformants 20 and 28 had an activity of 4 WSU / mL or more, Transformants 20, 28, 6, 64, 33, 11 and 48 had an activity of 3 WSU / mL, from 06/04/2018, p. . 128/244
113/127 transformants 20, 28, 6, 64, 33, 11, 48, 36, 35 and 1 had an activity of 2.5 WSU / mL or more, and transformants 20, 28, 6, 64, 33, 11, 48, 36, 35, 1, 43, 53 and 7 had an activity of 2 WSU / mL or more. All other transformants had an activity well below
1.5 WSU / mL.
To test whether transformant 20 also produced cellulase activity in the absence of an inducer, fermentation in shake flasks was carried out using Talaromyces medium 3. Supernatants were collected on days 3, 4 and 5 and were analyzed for WSU activity. The results of the WSU assay are shown in Table 3.
Table 3. Results of measurement of WSU activity in supernatants of an empty and transforming 20 strain of T.
emersonii in medium 3 of Talaromyces
Activity cellulase (WSU / mL) Strain Day 3 Day 4 Day 5 Transformer 20 6.1 7.7 8.1 (multiple cellulases recombinants) Empty strain 0.0 0.4 0.9
No cellulase activity was observed in the broths of day 3 of an empty strain, although some activity was observed at later points in time. On the other hand, the transformant that overexpressed multiple cellulases under the control of the glaA promoter showed WSU activity on day 3 (6.1 WSU / mL) and the activity increased even further over time.
This experiment gives strong indications that T. emersonii transformants that comprise multiple (4
Petition 870180047364, of 06/04/2018, p. 129/244
114/127 in this example, for example) cellulases under the control of the glaA promoter are capable of producing cellulase activity in glucose containing medium with or without cellulose. The transformant can be obtained by testing a combination of transformants that have been transformed with 4 cellulase constructs.
EXAMPLE 6
SECOND TRANSFORMATION OF TRANSFORMANTS Talaromyces emersonii
OVEREXPRESSION OF MULTIPLE CELLULASES IN Talaromyces emersonii
This example describes the second transformation of the EBAT147-1 transformant with (hemi) cellulases and as a second hygromycin B selection marker. The cloning of the unknown protein of T. emersonii, of T. emersonii swolenin, of T-acetyl xylan esterase is described emersonii and T. emersonii xylanase, and the transformation of T. emersonii EBAT147-1 with T. emersonii cellobiohydrolase-II (CBHII), T. emersonii beta-glucanase (EG) from T. emersonii, β-glucosidase ( BG) of T. emersonii, unknown protein of T. emersonii, swolenin of T. emersonii, acetyl xylan esterase from T. emersonii and with xylanase from T. emersonii.
Cloning of T. hemersonii (hemi) cellulases into expression vectors
The genes encoding the unknown T. emersonii protein and the T. emersonii swolenin were synthesized by DNA2.0 (Menlo Park, USA) and cloned as an EcoRI / SnaBI fragment into the pGBTOPl2 vector, comprising the glycoamylase promoter and the finishing sequence, from 06/04/2018, p. 130/244
115/127 resulting in the vector pGBTOPEBA224, and the vector pGBTOPEBA225, respectively. For cloning purposes, 198 nucleotides from part 3 'of the glycoamylase promoter were also synthesized with the genes. The amino acid sequences of the unknown T. emersonii protein and T. emersonii swolenin are represented by SEQ ID NO: 18 and 20, respectively. The DNA sequences of the genes are represented by SEQ ID NO: 19 and 21, respectively. pGBTOPEBA2 05 (Fig. 7) is representative of pGBTOPEBA224, which comprises the unknown T. emersonii protein, and of pGBTOPEBA225, which comprises T. emersonii swolenin.
The genes that encode T. emersonii acetyl xylan esterase (ACE) and T. emersonii xylanase were obtained from the T. emersonii cDNA library described in WO / 2001/070998. pGBFINEBAl76 (Figure 8) is representative of pGBFINEBAl93, which comprises T. emersonii ACE and pGBFINEBAl79 which comprises T. emersonii xylanase. The amino acid sequences of T. emersonii ACE and T. emersonii xylanase are represented by SEQ ID NO: 22 and 24, respectively. The DNA sequences of the genes are represented by SEQ ID NO: 23 and 25, respectively.
Transformation of T. emersonii with constructs that encode (hemi) cellulases
The transformation of T. emersonii with cellulose-encoding constructs was carried out as described in
EXAMPLE 5, except that instead of pAN8-l, carrying the phleomycin selection marker, pAN7 was used carrying the hygromycin selection marker B (Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CA. 1987. Transformation of Aspergillus based on the hygromycin B resistance marker of 06/04/2018, page 131/244
116/127 from Escherichia coli. Gene. 1987; 56 (1): 117-24. Altogether, 19 pg of DNA were used to co-transform T. emersonii: 1 pg of pAN7-l, 1 pg of each of the pGBTOPEBA4, pGBTOPEBA8, and pGBFINEBAl76 vectors, and 2.5 pg of each of the pGBTOPEBA205 vectors, pGBTOPEBA224, pGBTOPEBA225, pGBFINEBAl79 and PGBFINEBA193.
Tests for obtaining transformants with improved cellulase activity.
The transformants were collected from the plates and further analyzed, as described in EXAMPLE 5. Based on the results of SDS-PAGE and WSU, the most interesting transformant, EBAT147-2, was selected for the prpp of the spore batch and was tested in a 10-liter batch fermentation (see EXAMPLE 7).
Methods in Examples 7 and 8
Protein measurement assays
1. Total protein
The method was a combination of protein precipitation using trichloracetic acid (TCA) to remove disturbing substances and to allow determination of protein concentration with the Biuret colorimetric reaction. In the Biuret reaction, a copper (II) ion is reduced to copper (I) which forms a complex with the nitrogen and carbon atoms of the peptide bonds in an alkaline solution. A violet color indicates the presence of protein. The color intensity, and therefore the absorption at 546 nm, is directly proportional to the protein concentration, according to the Beer-Lambert law. Standardization was conducted using BSA (bovine serum albumin) and the protein content was expressed in g of protein from 06/04/2018, p. 132/244
117/127 as BSA / L equivalent or mg protein as BSA / mL equivalent. The protein content was calculated using standard calculation protocols known in the art, using the DO546 graph by the concentration of samples with known concentration, then calculating the concentration of unknown samples using the equation generated from the calibration line.
2. Individual proteins using proteomic analysis
APEX
Materials
The LC-MS / MS system consisted of an Accela and an LTQVelos by Thermo Fisher (San Jose, CA, USA). The columns were purchased from Agilent: C18 Zorbax 2.1 mm x 5 mm column with 1.8 pm particles. A fresh Heraeus centrifuge Biofuse was used for the centrifugation of eppendorf tubes, Beckman Coulter Allegra X-15R was used for the centrifugation of Greiner tubes. A comfort thermomixer from Eppendorf (Hamburg, Germany) was used for the incubations and Lo-bind tubes from Eppendorf were used for all experiments. Database searches were conducted using Sorcerer 2 (SageN, San Diego, CA, USA), a search engine operating the Trans-Proteomics Pipeline (TPP).
The identification results were processed using Absolute Protein Expression (APEX) software http: //pfgrc.j cvi.org/index.php/bioinformatics/apex.html, freeware to obtain amounts of protein.
The LC-MS buffers of category A and B, 0.1% formic acid (FA) in water and 0.1% FA in acetonitrile respectively were purchased from Biosolve (Valkenswaard, 06/04/2018, pg. 133/244
118/127
Netherlands). Bovine serum albumin (BSA), urea, Iodine Acetamide (IAA) and trichloracetic acid (TCA), 6.1 N solution, were purchased from Sigma Aldrich (St. Louis, MO, USA). The TCA solution was diluted 4.5 times to obtain a 20% TCA solution. Dithiothreitol (DTT) was purchased from Roche Applied Science (Indianapolis IN, USA). Formic acid (FA) was purchased from JT Baker (Phillipsburg, NJ, USA). Trypsin of a category for sequencing was purchased from Roche Applied Science (Penzberg, Germany).
TCA precipitation and thermomixing digestion.
The samples were carefully thawed and stored on ice as much as possible during sample preparation. The samples were diluted to a protein concentration of 5 mg / mL.
A sample of one hundred pL and 50 pL of 0.1 mg / mL BSA was diluted 1: 1 with 20% TCA. The samples were incubated at 4 ° C for 30 minutes and the proteins were reduced to granules by centrifugation for 10 minutes at 13000 rpm at 4 ° C. The supernatant was removed and the granules were washed with 200 µl of acetone at -20 ° C. The proteins were again granulated by centrifugation 10 minutes at 13,000 rpm at 4 ° C and the supernatant was removed.
The washed granules were dissolved in 75 pL of 8M urea. This solution was diluted with 392.5 pL of 100 mM NH4HCO3. Five pL of 500 mM DTT were added and the samples were incubated at room temperature for 30 minutes with maximum agitation in one. The cysteines were alkylated by adding 13.5 μA of 550 mM and by incubation to that of 04/06/2018, p. 134/244
119/127 room temperature for 30 minutes with maximum stirring in a thermomixer in the dark. Digestion was conducted by adding 20 µL of trypsin at 250 µg / mL at pH 3, and by incubation at 37 ° C overnight with maximum agitation in the thermomixer. Another 5 pL of trypsin at 250 pg / ml at pH 3 was added and digestion was continued for 3 hours at 37 ° C to ensure that the operation had been completed.
The samples were analyzed using the Accela LTQVelos system (Thermo Electron).
- Column: 1.8 pm Agilent C18 particle column
80-minute gradient of 5-40% AcN 0.1% Formic Acid
- 2 minutes 40-60% AcN 0.1% formic acid
- Flow of 400 pL / minute
- Injection volume: 20 pL
- Total operating time including injection, column washing and rebalancing 85 minutes.
- MS method: 10a intensified MS. double pass order m / z 300-2000 and MS / MS in the top 10 peaks
- Rejection of charge state allowing only 2+ and 3+ ions
- Dynamic exclusion: repeat 1, exclusion duration 10 seconds
Data analysis using Sorcerer and Spotfire
The data was searched by comparing it with the Talaromyces emersonii (TEMER) database, which was manually edited to contain the BSA internal standard sequences. The database search was conducted in Sorcerer 2, using TAMPÃO. The statistical analysis of the data was conducted from 06/04/2018, p. 135/244
120/127 using standard statistical tools.
Filter Paper Assay (FPU2% assay)
Cellulase activity was measured in terms of paper filter units (FPU) per milliliter in the Filter Paper Unit assay (FPU assay) of the original (indiluted) enzyme solution. The method was modified from the analytical procedure of Adney and Baker (1996, Moa Laboratory Analytical Procedures-006 entitled: Measurement of cellulase activities by Adney and Baker (1996) www.nrel.gov/biomass/analytical_procedures.html) more sensitive than the standard method which is based on the guidelines of the International Union of Pure and Applied Chemistry (IUPAC). For quantitative results, enzyme compositions were compared based on significant and equal conversions. The value of 1.0 mg of reducing sugar as glucose from 50 mg of filter paper (conversion of 2% instead of the international standard of 4%) in 60 minutes was designated as the point of intersection for the filter units calculation paper (FPU) by IUCA. In this procedure, the yield of reducing sugar is not a linear function of the amount of enzyme in the test mixture, it is not expected that twice the amount of enzyme will produce twice the amount of reducing sugar in equal time. The test procedure, therefore, involved discovering a dilution of the original enzyme material such that a 0.5 mL aliquot of the dilution catalyzed 2% conversion in 60 minutes, then calculating the activity (in FPU2prcc / mL) of the original material from the required dilution
FPU was calculated using the following formula:
of 06/04/2018, p. 136/244
121/127
Filter paper activity = 0.37 / ([Enzyme] releasing 1.0 mg of glucose) [Units / mL] [Enzyme] represents the proportion of the original enzyme solution present in the enzyme dilution directly tested.
Batch fermentation
Inoculation procedure:
vial content was added to a pre-culture medium: 2-liter shake bottle with baffle [20 g / L yeast extract, 20 g / L glucose, pH 6.8 (with KOH), 300 mL medium, steam sterilized for 20 minutes at 121 ° C]. Pre-culture was conducted for 214-48 hours at 48 ° C and 200 rpm. The time to be adapted to the configuration of shake flasks and the viability of the flasks.
Main fermentation procedure:
The medium was composed of a mixture of grain flour (3%), cellulose (6%), a nitrogen source (2.5%; examples of nitrogen sources known in the art include soy flour, yeast extract, infusion of corn, ammonia, ammonium salts, nitrate salts), as well as a fraction of salt. The salt fraction was according to WO98 / 37179, Table 1, p. 12. Deviations from this table were: CaCl2.2aq at 1.0 g / L, KC1 1.8 g / L citric acid, laq 0.45 g / L (chelating agent). The medium was sterilized with water vapor in a fraction. The bioreactors were inoculated with an inoculum proportion of ~ 10% and the operating volume was 10 L. The pH of the process was controlled between 5.0-3.0 (using phosphoric acid and ammonia), the temperature being 42-52 ° C.
of 06/04/2018, p. 137/244
122/127
The air flow was maintained between 0.5 and 1.5 vvm (volume of air per volume of juice per minute) and the DOT above 30% of oxygen saturation after inoculation for agitation. Clerol was used as a defoamer periodically: for 2 seconds every 30 minutes for the first 24 hours, then for 2 seconds every hour.
At the end of the pre-culture phase the samples were taken to check for contamination, glucose determination and pH measurement. During the main fermentation, samples were taken every 24 hours and the following analysis was carried out: contamination control, pH measurement, SDS-PAGE gels, determination of total protein concentration (Biuret TCA method) and Unit activity Paper Filter (FPU2% / mL), as described above
EXAMPLE 7
FERMENTATION OF THE TRANSFORMANT OF Talaromyces emersonii
THAT OVER-EXPRESSED MULTIPLE CELLULASES
This example describes the fermentation of T. emersonii transformants.
Two primary transformants described in EXAMPLE 5, transformant 20 (EBAT142-10 and transformant 64 (EBAT147-1) and a secondary transformant from EXAMPLE 6, EBAT147-2 were tested in a 10-liter batch fermentor in batch form. conditions that induced cellulases. As controls, empty strains were tested
FBG-142 and FBG-147.
At the end of the fermentation, TCA-Biuret and cellulase activity (FPU) were determined (Table 4).
of 06/04/2018, p. 138/244
123/127
Table 4. Results of TCA-biuret and measurement of FPU activity of T transformants supernatants.
emersonii and strains of empty host cells grown in a 10 liter production fermenter.
Strain Time (h) Protein fromTCA Biuret(mg / mL) ₂ % FPU / mL activityspecificof the mixture(FPU / MG) FBG-142 97 16, 4 15, 8 0.96 EBAT142-1 93 15, 7 20.9 1.33 FBG-147 95 17.4 17.3 0.99 EBAT147-1 93 19.1 21.6 1.13 EBAT147-2 93 19, 9 25 1.26
The results clearly demonstrated that T. emersonii transformants had increased cellulase activity compared to empty host strains. The EBAT142-1 transformant, which expresses all four cellulases (strain 20 in Figure 9), showed a 1.32-fold improvement in cellulase activity compared to the empty FBG-142 host. The EBAT147-1 transformant that expressed three cellulases (strain 64 in Figure
9) showed a 1.25-fold increase in cellulase activity compared to the empty FBG147 host. The secondary transformant, EBAT147-2 in which the levels of CBHI and BG were further increased compared to the host strain EBAT147-1 and in which acetyl xylan esterase was overexpressed (see EXAMPLE 8) showed an even greater increase in cellulase activity: EBAT147-2 produced 1.16 times more cellulase activity compared to the EBAT147-1 parent strain and an increase of
Petition 870180047364, of 06/04/2018, p. 139/244
124/127
1.44 times compared to the empty FBG-147 host strain.
In addition, cellulase activity per mg of protein was increased in transformants compared to the empty host strain. In the empty host strain <1 FPU / mg of protein was observed, whereas the primary transformants all had> 1.1 FPU / mg of protein. The secondary ΕΒΑΊΊ47-2 also showed an additional 1.11-fold increase in cellulase activity per mg of protein compared to the primary transformant EBAT147-1. In summary, the results suggest that the fraction of cellulases in the transformant supernatant was increased.
The experiment has a strong indication that it is possible to increase cellulase activity in addition to the production of endogenous cellulase by T. emersonii by overexpression of T. emersonii cellulases. In addition, a second transformation of an improved transformant showed an additional increase in cellulase activity.
EXAMPLE 8
PROTEOMIC ANALYSIS OF TRANSFORMANTS FROM Talaromyces emersonii THAT EXPRESSED MULTIPLE CELLULASES
This example describes the characterization of the primary transformant EBAT147-1 and the secondary transformant EBAT147'2 for increased levels of over-expressed cellulases, as determined by proteomic analysis.
The supernatants from 10-liter batch fermentations of FBG-147 and from the EBAT147-1 and EBAT1472 transformers (see EXAMPLE 7) were analyzed using APEX proteomic analysis. The relative amounts of cellulases, from 06/04/2018, p. 140/244
125/127 hemicellulases and accessory proteins are shown in
Table 5.
Table 5. Comparison of the relative levels of cellulase (APEX) of the FBG-147 strain of T. emersonii and the primary transformant EBAT147-1 and the secondary transformant EBAT147-2. Expressed as% of total protein as determined by
APEX
Enzyme / Protein FBG-147 EBAT147-1 EBAT147-2 CBH I 8.9 ± 0.4 12.5 ± 1.0 * 16.3 ± 4.7 * CBH II 7.3 ± 1.2 8.5 ± 2.0 7.7 ± 3.2 EG 1.5 ± 0.7 1.4 ± 0.7 1.0 ± 0.6 EG / CEA 3.9 ± 0.9 5.6 ± 0.8 * 5.0 ± 0.9 * EG / CEB 2. ± 0.9 2.1 ± 1.1 2.1 ± 0.1 BG 0.9 ± 0.1 1.5 ± 0.0 * 2.4 ± 0.3 = | = Xylanase 3.5 ± 0.1 3.2 ± 0.5 2.7 ± 0.5 Xylan acetylesterase 11.1 ± 3.7 5.3 ± 3.2 12.6 ± 4.3f EG / Family 61 8.6 ± 1.5 9.5 ± 6.5 8.1 ± 1.9 Proteinsimilar toswolenina 1.4 ± 0.4 1.0 ± 0.4 1.0 ± 0.2 Proteinunknown 3.4 ± 1.5 3.3 ± 1.3 3.9 ± 0.8 Total I ^b 36 ± 1 40 ± 6.7 48 ± 1.8 * Total II ^C 51 ± 3 54 ± 3.8 63 ± 5.7 * Protease 1.8 ± 0.3 1.1 ± 1.7 n. d Chitinase 0.4 ± 0.2 0.3 ± 0.4 0.1 ± 0.1
Petition 870180047364, of 06/04/2018, p. 141/244
126/127
₂ % FPU / mL
17.3
21, ^a Fermentation supernatants in 10-liter Eschweiler batches of approximately 95 hours were subjected to APEX analysis. All values are expressed as percentages of the detected proteins. Values marked with an asterisk indicate levels that vary statistically significantly between FBG-147 and descending strains (bp value 0.05 in Student's T test, two-sided, uneven variance). The values marked with a = | = indicate levels that change statistically significantly between EBAT147-1 and the descending strain (bp value 0.05 in Student's T test, two sides, unequal variance). TEC levels in the form of FPU2% / mL of batch fermentations are shown below.
^b The total cellulase content (as determined by
APEX, expressed as% protein detected by APEX proteomics analysis), the sum of CBH I, CBH II, EG, EG / CEA, EG / CEG, BG, EG / family 61 (as described in the patent application European EP 10167771.4), swolenin-like protein (as described in European patent application EP10167764.2) listed in Table 5.
^c The total content of cellulases and xylanases (as determined by APEX, expressed in% of the protein detected by APEX proteomic analysis): Total cellulase (% of protein detected by APEX proteomic analysis) as defined above in ^b + xylanase + acetyl xylan esterase , listed in Table 5.
The results clearly show that 3 cellulases were significantly overexpressed in the EBAT147-1 transformant compared to FBG-147: CBH I expressed at
Petition 870180047364, of 06/04/2018, p. 142/244
127/127 from plasmid pGBTOPEBA205 and BG expressed from plasmid pGBTOPEBA4 were further increased compared to primary transformant EBAT147-1, and in addition, acetyl xylan esterase expressed from plasmid pGBFINEBAl93 was overexpressed.
The total cellulase content listed in Table 5 showed that the fraction of cellulases in the total amount of the detected protein is increased in the transformants.
The experiment gives strong indications that T. emersonii cellulases can be overexpressed by the transformation of T. emersonii with a multiplicity of expression cassettes that encode cellulases, and the levels of cellulases may be even higher by a second transformation of a cell. primary transformer. The results explain the increase in cellulase activity of the transformants described in EXAMPLE 6. In addition, the fraction of cellulases in the amount of total secreted protein produced by T. emersonii can be increased by overexpression of cellulases, which is according to an increase in cellulase activity per mg of protein observed in the transformants (EXAMPLE 6).
of 06/04/2018, p. 143/244
1/4

权利要求:
Claims (12)
[1]
1. Process for the production of a Talaromyces transformant, FEATURED for understanding the steps of:
(a) providing one or more expression cassettes capable of producing one or more polypeptides of interest and comprising one or more polynucleotides of interest encoding cellulase and at least one promoter for the expression of the polynucleotide;
(b) providing a selection marker included in the expression cassette of (a) or included in a dedicated selection marker polynucleotide;
(c) transfecting a Talaromyces host with one or more expression cassettes from (a) and / or the selection marker from (b);
(d) selecting a Talaromyces transformant that contains two or more recombinant genes capable of expressing cellulase, and (e) isolating the Talaromyces transformant.
[2]
2. Talaromyces transformant, CHARACTERIZED for harboring two or more recombinant genes capable of expressing cellulase, capable of producing cellulase in the absence of a cellulase inducer in a glucose medium, having a cellulase activity of 2 Units of Straw
Wheat (WSU) / mL or more in a supernatant or broth diluted 16 times or more, and which can be obtained as defined in claim 1.
[3]
3. Talaromyces transformant according to claim 2, CHARACTERIZED for having an endoglucanase activity of 50 WBCU / ml or more.
[4]
4. Talaromyces transformant, according to that of 06/04/2018, p. 144/244
2/4 claim 2 or 3, CHARACTERIZED by the fact that the two or more genes capable of expressing cellulase include the cellobiohydrolase, endoglucanase and / or betaglycosidase gene.
[5]
5. Talaromyces transformant according to any of claims 2 to 4, CHARACTERIZED by the fact that one or more genes are integrated into the genome of the Talaromyces transformant.
[6]
6. Talaromyces transformant according to any one of claims 2 to 5, CHARACTERIZED by the fact that the Talaromyces transformant is marker-free.
[7]
7. Process for the production of a polypeptide composition comprising one or more cellulases, CHARACTERIZED by understanding the steps of:
providing one or more expression cassettes capable of producing one or more polypeptides of interest and comprising one or more polynucleotides of interest that encode cellulase and at least one promoter for expression of the polynucleotide;
providing a selection marker included in the expression cassette of (a) or included in a dedicated selection marker polynucleotide;
transfecting a Talaromyces host with one or more expression cassettes from (a) and / or the selection marker from b);
selecting a Talaromyces transformant that contains two or more recombinant genes capable of expressing cellulase; and produce the polypeptide composition through 06/04/2018, p. 145/244
3/4 culture of the Talaromyces transformant in a suitable culture medium in which a cellulase inducer is absent.
[8]
8. Process according to claim 7, CHARACTERIZED by the fact that in step (a) two or more expression cassettes, three or more expression cassettes or four or more expression cassettes are provided.
[9]
9. Process for saccharification of lignocellulosic material, CHARACTERIZED by the fact that the lignocellulosic material that has been previously treated is placed in contact with Talaromyces transformant as defined in any one of claims 2 to 6, and in which one or more sugars are produced .
[10]
10. Process for the preparation of a fermentation product, including amino acids, vitamins, pharmaceuticals, animal feed supplements, special chemicals, chemical raw materials, plastics, solvents, fuels, or other organic polymers, lactic acid, ethanol, ethanol fuel or chemicals, plastics, such as succinic acid and (bio) fuels, including synthetic liquid fuels from ethanol, methanol, butanol and biogas, CHARACTERIZED by the fact that one or more sugars produced by the process as defined in claim 9 are fermented with a fermentation microorganism, preferably yeast, to produce the fermentation product.
[11]
11. Process for the production of a multiple Talaromyces transformant, CHARACTERIZED by the fact that in a first transformation as defined in the claim of 06/04/2018, p. 146/244
4/4
1, the Talaromyces transformant isolated in step (e) of a first transformation is used as a host of Talaromyces and is transformed into a second transformation as defined in claim 1 and in step (e) of the second
5 transformation a Talaromyces multiple transformant is isolated.
[12]
12. Process, according to claim 11, CHARACTERIZED by the fact that in the first transformation a different selection marker is used than in the second
10 transformation.
Petition 870180047364, of 06/04/2018, p. 147/244
1 2 3 4 5 6 7 Β 9 1011 12 βΜΒΒΒΒΒοΜΒΒΒΙ
Β!
Μ
ΒΒ
Μ ϊΝτ / * ''. $ 1'-. * τ '· ν ^ k
afe ^ -Sg ^ g
„., ________ I _____ ~ __U

类似技术:

---

公开号 | 公开日 | 专利标题

---

US8802415B2|2014-08-12|Talaromyces transformants

---

ES2672125T3|2018-06-12|Polypeptide that has beta-glucosidase activity and uses thereof

---

ES2802807T3|2021-01-21|Carbohydrate degrading polypeptide and its uses

---

US9133448B2|2015-09-15|Polypeptide having cellobiohydrolase activity and uses thereof

---

US9121013B2|2015-09-01|Polypeptide having beta-glucosidase activity and uses thereof

---

US9163224B2|2015-10-20|Carbohydrate degrading polypeptide and uses thereof

---

BR112012033404B1|2021-05-18|recombinant cell, method for preparing a polypeptide, composition, method for treating a substrate comprising carbohydrate material and use of a polypeptide

---

US9163223B2|2015-10-20|Polypeptide having acetyl xylan esterase activity and uses thereof

---

US9109213B2|2015-08-18|Polypeptide having carbohydrate degrading activity and uses thereof

---

US9175050B2|2015-11-03|Polypeptide having swollenin activity and uses thereof

---

AU2014280943A1|2015-01-22|Talaromyces transformants

同族专利:

---

公开号 | 公开日

---

WO2011054899A1|2011-05-12|

---

US8802415B2|2014-08-12|

---

BR112012011596A2|2016-05-31|

---

EA021636B1|2015-07-30|

---

CA2779796A1|2011-05-12|

---

CN102597213A|2012-07-18|

---

AU2010317063A1|2012-05-24|

---

AU2010317063B2|2014-10-23|

---

IN2012DN03186A|2015-09-25|

---

US20120276567A1|2012-11-01|

---

EA201200688A1|2012-12-28|

---

EP2955221A1|2015-12-16|

---

MX2012005271A|2012-06-28|

---

EP2496686A1|2012-09-12|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4288627A|1980-02-12|1981-09-08|Phillips Petroleum Company|Oxidation of thiols employing cobalt molybdate/triethylamine catalyst|

---

DE69432543T2|1993-07-23|2003-12-24|Dsm Nv|Selection marker gene-free recombinant strains: process for their preparation and the use of these strains|

---

JPH11501217A|1995-08-03|1999-02-02|ギストブロカデスベスローテンフェンノートシャップ|Use of the homologous amdS gene as a selectable marker|

---

EP0970236B1|1997-02-20|2006-05-24|DSM IP Assets B.V.|Fermentative production of valuable compounds on an industrial scale using chemically defined media|

---

AT367439T|1997-12-22|2007-08-15|Dsm Ip Assets Bv|EXPRESSION CLONING IN FILAMENTOUS MUSHROOMS|

---

US6058898A|1998-12-28|2000-05-09|Detroit Diesel Corporation|Structural oil pan with integrated oil filtration and cooling system|

---

JP2000189757A|1998-12-30|2000-07-11|Volvo Ab|Catalytic purification device|

---

WO2001070998A1|2000-03-20|2001-09-27|Dsm N.V.|Talaromyces emersonii beta-glucanases|

---

JP4878428B2|2000-09-21|2012-02-15|ベーアーエスエフ・アクチエンゲゼルシャフト|Talalomyces xylanase|

---

WO2005095624A2|2004-04-02|2005-10-13|Dsm Ip Assets B.V.|Filamentous fungal mutants with improved homologous recombination efficiency|

---

CN1942586B|2004-04-16|2011-08-10|帝斯曼知识产权资产管理有限公司|Fungal promoters for expressing a gene in a fungal cell|

---

US7202419B2|2004-07-20|2007-04-10|Dragonwave Inc.|Multi-layer integrated RF/IF circuit board including a central non-conductive layer|

---

CA2595056A1|2005-01-24|2006-07-27|Dsm Ip Assets B.V.|Method for producing a compound of interest in a filamentous fungal cell|

---

CA2599180A1|2005-03-01|2006-09-08|Dsm Ip Assets B.V.|Aspergillus promotors for expressing a gene in a fungal cell|

---

IES20060090A2|2006-02-10|2007-06-13|Nat Univ Ireland|Talaromyces emersonii enzyme systems|

---

DK2004827T3|2006-04-08|2010-06-14|Dsm Ip Assets Bv|Improved method for homologous recombination in fungal cells|

---

WO2008053018A2|2006-11-02|2008-05-08|Dsm Ip Assets B.V.|Improved production of secreted proteins by filamentous fungi|

---

EP2631295A3|2007-02-15|2014-01-01|DSM IP Assets B.V.|A recombinant host cell for the production of a compound of interest|MX2012009282A|2010-02-11|2012-09-07|Dsm Ip Assets Bv|Polypeptide having cellobiohydrolase activity and uses thereof.|

---

CA2789301A1|2010-02-11|2011-08-18|Dsm Ip Assets B.V.|Host cell capable of producing enzymes useful for degradation of lignocellulosic material|

---

MX2012015142A|2010-06-29|2013-05-01|Dsm Ip Assets Bv|Polypeptide having beta-glucosidase activity and uses thereof.|

---

WO2012000887A1|2010-06-29|2012-01-05|Dsm Ip Assets B.V.|Polypeptide having swollenin activity and uses thereof|

---

DK2668265T3|2011-01-26|2017-10-16|Novozymes As|Hitherto unknown glycoside hydrolases from thermophilic fungi|

---

MX2013007720A|2011-01-26|2013-08-09|Novozymes As|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.|

---

EP2683732B1|2011-03-11|2016-08-24|DSM IP Assets B.V.|Vector-host system|

---

ES2672048T3|2011-08-04|2018-06-12|Novozymes Inc.|Polypeptides with xylanase activity and polynucleotides that encode them|

---

US9708591B2|2011-11-18|2017-07-18|Novozymes Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

CN104053666A|2011-11-18|2014-09-17|诺维信股份有限公司|Polypeptides Having Endoglucanase Activity And Polynucleotides Encoding Same|

---

WO2013189878A1|2012-06-19|2013-12-27|Dsm Ip Assets B.V.|Promoters for expressing a gene in a cell|

---

EP3070165A1|2013-02-04|2016-09-21|DSM IP Assets B.V.|Carbohydrate degrading polypeptide and uses thereof|

---

EP2992331A4|2013-04-30|2017-03-29|Université de Montréal|Novel biomarkers for acute myeloid leukemia|

---

WO2014182990A1|2013-05-10|2014-11-13|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

WO2014202622A2|2013-06-19|2014-12-24|Dsm Ip Assets B.V.|Rasamsonia gene and use thereof|

---

WO2014202616A2|2013-06-19|2014-12-24|Dsm Ip Assets B.V.|Rasamsonia gene and use thereof|

---

WO2014202624A2|2013-06-19|2014-12-24|Dsm Ip Assets B.V.|Rasamsonia gene and use thereof|

---

WO2014202620A2|2013-06-19|2014-12-24|Dsm Ip Assets B.V.|Rasamsonia gene and use thereof|

---

WO2014202621A1|2013-06-20|2014-12-24|Dsm Ip Assets B.V.|Carbohydrate degrading polypeptide and uses thereof|

---

WO2015081139A1|2013-11-26|2015-06-04|Novozymes A/S|Enzyme compositions and uses thereof|

---

WO2015174518A1|2014-05-15|2015-11-19|株式会社Ｉｈｉ環境エンジニアリング|Liquid fuel production method using biomass|

---

DK3152315T3|2014-06-06|2018-11-26|Novozymes As|ENZYME COMPOSITIONS AND APPLICATIONS THEREOF|

---

WO2016110453A1|2015-01-06|2016-07-14|Dsm Ip Assets B.V.|A crispr-cas system for a filamentous fungal host cell|

---

WO2018019948A1|2016-07-29|2018-02-01|Dsm Ip Assets B.V.|Polypeptides having cellulolytic enhancing activity and uses thereof|

---

CN107022535B|2017-04-24|2020-07-14|中国农业科学院饲料研究所|Multi-domain acid cellulase derived from fungi as well as gene and application thereof|

---

KR20200056437A|2017-09-25|2020-05-22|아지노모토 가부시키가이샤|Protein production and disaccharide production|

---

WO2022013775A1|2020-07-17|2022-01-20|Pfizer Inc.|Therapeutic antibodies and their uses|

法律状态:
2016-06-14| B27A| Filing of a green patent (patente verde)|

---

2016-07-26| B27B| Request for a green patent granted|

---

2016-09-06| B06F| Objections, documents and/or translations needed after an examination request according art. 34 industrial property law|

---

2016-12-20| B27C| Request for a green patent denied|Free format text: O PEDIDO NAO ESTA APTO A PARTICIPAR DO PROGRAMA DE PATENTES VERDES.DESTA DATA CORRE PRAZO DE 60(SESSENTA) DIA PARA EVENTUAL RECURSO DO INTERESSADO |

---

2017-08-15| B27G| Cancellation of publication of a green patent|

---

2018-03-06| B07A| Technical examination (opinion): publication of technical examination (opinion)|

---

2018-08-14| B09A| Decision: intention to grant|

---

2018-10-02| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 04/11/2010, OBSERVADAS AS CONDICOES LEGAIS. |

---

2019-08-27| B21F| Lapse acc. art. 78, item iv - on non-payment of the annual fees in time|Free format text: REFERENTE A 9A ANUIDADE. |

---

2019-12-17| B24J| Lapse because of non-payment of annual fees (definitively: art 78 iv lpi, resolution 113/2013 art. 12)|Free format text: EM VIRTUDE DA EXTINCAO PUBLICADA NA RPI 2538 DE 27-08-2019 E CONSIDERANDO AUSENCIA DE MANIFESTACAO DENTRO DOS PRAZOS LEGAIS, INFORMO QUE CABE SER MANTIDA A EXTINCAO DA PATENTE E SEUS CERTIFICADOS, CONFORME O DISPOSTO NO ARTIGO 12, DA RESOLUCAO 113/2013. |

优先权:

---

申请号 | 申请日 | 专利标题

---

EP09174990|2009-11-04|

---

PCT/EP2010/066796|WO2011054899A1|2009-11-04|2010-11-04|Talaromyces transformants|

---